Incidental Mutation 'R0317:Fam196b'
ID25473
Institutional Source Beutler Lab
Gene Symbol Fam196b
Ensembl Gene ENSMUSG00000069911
Gene Namefamily with sequence similarity 196, member B
SynonymsGm6041
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location34314822-34422640 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 34402826 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 289 (D289E)
Ref Sequence ENSEMBL: ENSMUSP00000129183 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000093192] [ENSMUST00000093193] [ENSMUST00000101364] [ENSMUST00000101365] [ENSMUST00000165963]
Predicted Effect possibly damaging
Transcript: ENSMUST00000093192
AA Change: D289E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000090883
Gene: ENSMUSG00000069911
AA Change: D289E

DomainStartEndE-ValueType
Pfam:FAM196 1 535 3.6e-196 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000093193
SMART Domains Protein: ENSMUSP00000090884
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 2e-113 PFAM
Pfam:DOCK-C2 419 616 1e-60 PFAM
Pfam:DHR-2 1114 1614 6.3e-96 PFAM
low complexity region 1691 1706 N/A INTRINSIC
low complexity region 1793 1800 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000101364
Predicted Effect probably benign
Transcript: ENSMUST00000101365
SMART Domains Protein: ENSMUSP00000098916
Gene: ENSMUSG00000020143

DomainStartEndE-ValueType
SH3 11 68 1.22e-11 SMART
Pfam:DOCK_N 71 414 1.4e-113 PFAM
Pfam:DOCK-C2 419 616 5.5e-61 PFAM
low complexity region 1163 1171 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000165963
AA Change: D289E

PolyPhen 2 Score 0.941 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000129183
Gene: ENSMUSG00000069911
AA Change: D289E

DomainStartEndE-ValueType
Pfam:FAM196 3 535 1.3e-168 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype NO_PHENOTYPE,Homozygous mutants are defective in the migration of T and B lympohcytes in response to chemokines, and thus display immune defects such as lymphocytopenia, atrophy of lymphoid follicles and loss of marginal-zone B cells.
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc2a4 C T 11: 69,946,356 V85M probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Fam196b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00897:Fam196b APN 11 34403011 missense probably benign
IGL01867:Fam196b APN 11 34403065 missense probably benign 0.39
PIT4677001:Fam196b UTSW 11 34403122 missense probably benign
R1165:Fam196b UTSW 11 34402740 missense probably benign
R1710:Fam196b UTSW 11 34404263 splice site probably null
R2083:Fam196b UTSW 11 34402141 missense probably benign 0.01
R2096:Fam196b UTSW 11 34402936 missense probably benign 0.03
R3820:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3821:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3822:Fam196b UTSW 11 34403007 missense probably benign 0.01
R3969:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3970:Fam196b UTSW 11 34419739 missense probably damaging 0.99
R3980:Fam196b UTSW 11 34402678 missense probably benign 0.00
R4092:Fam196b UTSW 11 34401935 start gained probably benign
R4231:Fam196b UTSW 11 34403143 missense probably benign 0.01
R4678:Fam196b UTSW 11 34403227 missense probably damaging 1.00
R4859:Fam196b UTSW 11 34403154 missense probably benign 0.31
R4938:Fam196b UTSW 11 34402231 missense probably damaging 0.98
R5269:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5287:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5358:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5359:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5361:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5362:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5363:Fam196b UTSW 11 34402788 missense probably damaging 1.00
R5403:Fam196b UTSW 11 34403058 missense probably benign 0.12
R5705:Fam196b UTSW 11 34404349 missense probably damaging 1.00
R6282:Fam196b UTSW 11 34402819 missense possibly damaging 0.77
R7030:Fam196b UTSW 11 34402030 missense probably damaging 0.96
R7069:Fam196b UTSW 11 34402677 missense possibly damaging 0.48
R7178:Fam196b UTSW 11 34402359 missense probably damaging 0.96
R7180:Fam196b UTSW 11 34419873 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTGCTTTGATCTCCATGTGTCCAGG -3'
(R):5'- AGTTGCTCACTTCCAACACCAGTC -3'

Sequencing Primer
(F):5'- CATGTGTCCAGGGGATGG -3'
(R):5'- AGACTTGGATGCACTGCTAC -3'
Posted On2013-04-16