Incidental Mutation 'R2913:Yes1'
ID254743
Institutional Source Beutler Lab
Gene Symbol Yes1
Ensembl Gene ENSMUSG00000014932
Gene NameYES proto-oncogene 1, Src family tyrosine kinase
SynonymsYes
MMRRC Submission 040500-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.824) question?
Stock #R2913 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location32611171-32687057 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 32640582 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 82 (S82P)
Ref Sequence ENSEMBL: ENSMUSP00000144001 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000072311] [ENSMUST00000168707] [ENSMUST00000200999] [ENSMUST00000202543]
Predicted Effect probably benign
Transcript: ENSMUST00000072311
AA Change: S82P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000072154
Gene: ENSMUSG00000014932
AA Change: S82P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000155976
Predicted Effect probably benign
Transcript: ENSMUST00000168707
AA Change: S82P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000132161
Gene: ENSMUSG00000014932
AA Change: S82P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000200999
AA Change: S82P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144355
Gene: ENSMUSG00000014932
AA Change: S82P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 3.1e-24 SMART
SH2 154 198 2e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000202543
AA Change: S82P

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000144001
Gene: ENSMUSG00000014932
AA Change: S82P

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
SH3 92 149 5.03e-22 SMART
SH2 154 244 8.4e-35 SMART
TyrKc 275 524 8.39e-131 SMART
Meta Mutation Damage Score 0.03 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is the cellular homolog of the Yamaguchi sarcoma virus oncogene. The encoded protein has tyrosine kinase activity and belongs to the src family of proteins. This gene lies in close proximity to thymidylate synthase gene on chromosome 18, and a corresponding pseudogene has been found on chromosome 22. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null alleles have no overt phenotype, but mice homozygous for both Yes and Src null mutations exhibit impaired movement and breathing, resulting in perinatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,270,685 S3159P unknown Het
5430419D17Rik T C 7: 131,182,024 S49P possibly damaging Het
9530053A07Rik A T 7: 28,164,307 L2501F probably damaging Het
Acap2 T C 16: 31,116,069 Q357R probably damaging Het
Adap1 C T 5: 139,274,821 probably null Het
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Aldh3b1 T C 19: 3,921,275 probably benign Het
Arih2 A G 9: 108,644,076 S68P probably damaging Het
Col1a2 C T 6: 4,519,923 probably benign Het
Crocc C T 4: 141,020,350 R1496H probably damaging Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Cyp11b1 T C 15: 74,836,421 T402A probably damaging Het
Etfa C A 9: 55,482,329 A254S probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hbb-bh1 C T 7: 103,843,047 E22K possibly damaging Het
Hmcn2 A G 2: 31,460,210 T5040A possibly damaging Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Igsf10 T A 3: 59,331,736 L341F possibly damaging Het
Ints1 A G 5: 139,757,913 S1592P possibly damaging Het
Itgam T C 7: 128,112,406 I641T probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk3 T A 7: 126,760,806 C19* probably null Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Med26 T G 8: 72,496,112 K381T possibly damaging Het
Mki67 T C 7: 135,700,686 E873G possibly damaging Het
Mrgpra9 T C 7: 47,235,080 I280V probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Pam A C 1: 97,923,129 L168R probably damaging Het
Pikfyve G A 1: 65,253,517 V1376M probably damaging Het
Pomt2 A T 12: 87,128,969 N400K probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rc3h2 A G 2: 37,378,959 S832P possibly damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Rrh G T 3: 129,815,609 A83E probably damaging Het
Rspo2 T A 15: 43,078,114 T138S probably benign Het
Skint5 A G 4: 113,524,092 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Spata31d1d T C 13: 59,726,955 E922G possibly damaging Het
Spc25 T C 2: 69,199,987 H104R probably benign Het
Sptssa A T 12: 54,656,482 M1K probably null Het
Srrm2 G T 17: 23,815,684 probably benign Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmem181c-ps A G 17: 6,621,209 noncoding transcript Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Trio T A 15: 27,854,912 Q728L probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Vwf T A 6: 125,685,846 V2731E probably benign Het
Zgrf1 T C 3: 127,598,707 V1292A possibly damaging Het
Other mutations in Yes1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00514:Yes1 APN 5 32655129 missense probably benign 0.00
IGL02816:Yes1 APN 5 32645107 missense probably damaging 1.00
IGL02974:Yes1 APN 5 32660768 missense probably damaging 0.97
PIT4696001:Yes1 UTSW 5 32684625 missense possibly damaging 0.70
R0139:Yes1 UTSW 5 32684695 missense possibly damaging 0.87
R0481:Yes1 UTSW 5 32640405 nonsense probably null
R0486:Yes1 UTSW 5 32655582 nonsense probably null
R0526:Yes1 UTSW 5 32655240 missense probably benign 0.15
R0648:Yes1 UTSW 5 32655518 missense possibly damaging 0.90
R1083:Yes1 UTSW 5 32651757 critical splice donor site probably null
R1463:Yes1 UTSW 5 32651702 missense probably benign 0.04
R1569:Yes1 UTSW 5 32653163 missense probably damaging 1.00
R1899:Yes1 UTSW 5 32645051 missense probably damaging 1.00
R1918:Yes1 UTSW 5 32684735 missense probably benign 0.00
R2183:Yes1 UTSW 5 32645026 missense probably damaging 1.00
R2914:Yes1 UTSW 5 32640582 missense probably benign
R3104:Yes1 UTSW 5 32653171 missense probably damaging 1.00
R4407:Yes1 UTSW 5 32640585 missense possibly damaging 0.51
R4736:Yes1 UTSW 5 32660777 missense probably damaging 0.98
R4939:Yes1 UTSW 5 32645113 splice site probably null
R6187:Yes1 UTSW 5 32645041 missense probably damaging 1.00
R6318:Yes1 UTSW 5 32651686 missense possibly damaging 0.92
R6467:Yes1 UTSW 5 32653037 missense probably damaging 0.98
X0062:Yes1 UTSW 5 32653043 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGCAGATTTGATAATGGGCTGC -3'
(R):5'- AGCCTGCCCTTTGTTAGAG -3'

Sequencing Primer
(F):5'- TACAGAGCCTGTAAGCCCAAGTG -3'
(R):5'- GCCCTTTGTTAGAGAACTTATTTGC -3'
Posted On2014-12-29