Incidental Mutation 'R0317:Slc2a4'
ID25476
Institutional Source Beutler Lab
Gene Symbol Slc2a4
Ensembl Gene ENSMUSG00000018566
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 4
SynonymsGlut-4, Glut4
MMRRC Submission 038527-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.808) question?
Stock #R0317 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location69942539-69948188 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 69946356 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 85 (V85M)
Ref Sequence ENSEMBL: ENSMUSP00000136726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018698] [ENSMUST00000018710] [ENSMUST00000108601] [ENSMUST00000135437] [ENSMUST00000141837] [ENSMUST00000142500] [ENSMUST00000149194] [ENSMUST00000178363] [ENSMUST00000179298]
Predicted Effect probably benign
Transcript: ENSMUST00000018698
SMART Domains Protein: ENSMUSP00000018698
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 2 68 N/A INTRINSIC
low complexity region 71 82 N/A INTRINSIC
CSP 96 164 2.54e-21 SMART
low complexity region 173 212 N/A INTRINSIC
low complexity region 220 242 N/A INTRINSIC
low complexity region 274 294 N/A INTRINSIC
low complexity region 317 339 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000018710
AA Change: V85M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000018710
Gene: ENSMUSG00000018566
AA Change: V85M

DomainStartEndE-ValueType
Pfam:MFS_1 24 436 3.9e-16 PFAM
Pfam:Sugar_tr 27 483 1.7e-155 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000108601
SMART Domains Protein: ENSMUSP00000104242
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
CSP 19 87 2.54e-21 SMART
low complexity region 96 135 N/A INTRINSIC
low complexity region 143 165 N/A INTRINSIC
low complexity region 197 217 N/A INTRINSIC
low complexity region 240 262 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000118013
Predicted Effect probably benign
Transcript: ENSMUST00000135437
SMART Domains Protein: ENSMUSP00000137092
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
Pfam:Sugar_tr 1 57 5.3e-13 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000141837
AA Change: V85M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136806
Gene: ENSMUSG00000018566
AA Change: V85M

DomainStartEndE-ValueType
Pfam:MFS_1 24 438 4.7e-17 PFAM
Pfam:Sugar_tr 26 453 6e-140 PFAM
low complexity region 462 478 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142500
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148395
Predicted Effect probably benign
Transcript: ENSMUST00000149194
SMART Domains Protein: ENSMUSP00000136684
Gene: ENSMUSG00000018554

DomainStartEndE-ValueType
low complexity region 4 17 N/A INTRINSIC
low complexity region 25 47 N/A INTRINSIC
low complexity region 79 99 N/A INTRINSIC
low complexity region 122 144 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000152487
Predicted Effect probably benign
Transcript: ENSMUST00000178363
SMART Domains Protein: ENSMUSP00000136455
Gene: ENSMUSG00000018566

DomainStartEndE-ValueType
PDB:4PYP|A 14 50 3e-10 PDB
Predicted Effect noncoding transcript
Transcript: ENSMUST00000178809
Predicted Effect probably damaging
Transcript: ENSMUST00000179298
AA Change: V85M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000136726
Gene: ENSMUSG00000018566
AA Change: V85M

DomainStartEndE-ValueType
Pfam:Sugar_tr 26 242 6.9e-65 PFAM
Pfam:MFS_1 27 239 2e-10 PFAM
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.2%
  • 10x: 96.1%
  • 20x: 92.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is a member of the solute carrier family 2 (facilitated glucose transporter) family and encodes a protein that functions as an insulin-regulated facilitative glucose transporter. In the absence of insulin, this integral membrane protein is sequestered within the cells of muscle and adipose tissue. Within minutes of insulin stimulation, the protein moves to the cell surface and begins to transport glucose across the cell membrane. Mutations in this gene have been associated with noninsulin-dependent diabetes mellitus (NIDDM). [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous inactivation of this gene causes impaired glucose metabolism in skeletal muscle and adipose tissue. Mice homozygous for a knock-out allele show premature death associated with cardiac hypertrophy, growth retardation, insulin resistance, reduced adipose tissue deposits, and muscle fatigue. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 58 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca13 T C 11: 9,293,459 V1774A probably damaging Het
Adam34 G A 8: 43,652,251 P119L probably benign Het
Ap3b2 T C 7: 81,463,681 probably null Het
Arfip2 G A 7: 105,637,223 T124M probably damaging Het
Arhgef26 T C 3: 62,423,544 S560P probably damaging Het
Bcl11a A T 11: 24,172,697 probably null Het
Cab39 A G 1: 85,849,160 E322G probably damaging Het
Cad C A 5: 31,072,321 P1382Q probably benign Het
Cc2d2a T C 5: 43,706,901 probably null Het
Cela2a A T 4: 141,821,700 probably null Het
Ces1e A C 8: 93,224,039 I38S probably benign Het
Ces1f A T 8: 93,263,391 F364I probably benign Het
Chgb A G 2: 132,793,811 T558A probably benign Het
Cnpy4 C T 5: 138,192,812 Q217* probably null Het
Col4a3bp C T 13: 96,634,121 R487* probably null Het
Crlf1 A G 8: 70,498,599 T43A probably benign Het
Dnah7b T A 1: 46,134,656 M707K probably damaging Het
Ets2 G A 16: 95,712,149 S123N probably damaging Het
Fam196b C A 11: 34,402,826 D289E possibly damaging Het
Fry T C 5: 150,471,468 F304S probably damaging Het
Gadd45gip1 G A 8: 84,834,116 R120H probably benign Het
Gbf1 A G 19: 46,254,020 T96A probably benign Het
Ggn T A 7: 29,171,090 M1K probably null Het
Gm5239 A G 18: 35,536,916 T112A probably benign Het
Kif1bp A T 10: 62,578,082 probably null Het
Lrrc15 A T 16: 30,273,743 H259Q probably benign Het
Lysmd4 A G 7: 67,226,297 Y236C probably damaging Het
Med29 T C 7: 28,386,859 T175A possibly damaging Het
Mfsd12 G T 10: 81,357,799 D68Y probably damaging Het
Myh1 T C 11: 67,217,512 L1308P probably damaging Het
Nphp4 T A 4: 152,551,931 probably null Het
Olfr948 A G 9: 39,319,461 I51T probably benign Het
Pdhx A G 2: 103,028,280 V393A probably benign Het
Pgm5 A G 19: 24,824,399 I155T possibly damaging Het
Pgr A T 9: 8,965,022 I889F probably benign Het
Phactr4 T A 4: 132,386,930 K51I probably damaging Het
Pum2 T A 12: 8,728,754 I468K possibly damaging Het
Rab11a A G 9: 64,725,553 S24P probably damaging Het
Rasef T C 4: 73,748,562 Q160R probably damaging Het
Rbl2 A G 8: 91,087,144 D339G probably benign Het
Recql5 A G 11: 115,894,673 S666P probably benign Het
Rfc1 A T 5: 65,296,052 probably null Het
Scarb1 A G 5: 125,289,692 V59A probably damaging Het
Slc6a12 A G 6: 121,358,625 I291V possibly damaging Het
Slco3a1 A C 7: 74,504,426 Y104D probably damaging Het
Suz12 T A 11: 79,999,078 D13E probably damaging Het
Tlr1 G T 5: 64,925,967 C422* probably null Het
Tmco1 T C 1: 167,325,893 V114A probably damaging Het
Trpa1 T C 1: 14,881,632 T948A probably benign Het
Tub A T 7: 109,020,927 N93Y probably damaging Het
Ufsp2 G A 8: 45,992,233 probably null Het
Veph1 T C 3: 66,171,975 D373G probably benign Het
Vmn1r206 A G 13: 22,620,960 S26P possibly damaging Het
Vmn2r1 T C 3: 64,081,819 S60P possibly damaging Het
Wdcp A G 12: 4,851,583 S480G probably benign Het
Wnk4 T C 11: 101,268,804 S612P probably benign Het
Zfp503 T C 14: 21,986,459 K130E probably benign Het
Zkscan16 G A 4: 58,957,602 C628Y possibly damaging Het
Other mutations in Slc2a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01065:Slc2a4 APN 11 69945956 splice site probably benign
IGL01448:Slc2a4 APN 11 69945076 missense possibly damaging 0.80
IGL01593:Slc2a4 APN 11 69944828 missense probably damaging 0.98
IGL02188:Slc2a4 APN 11 69946330 start codon destroyed probably null 0.00
IGL02738:Slc2a4 APN 11 69946114 missense probably damaging 1.00
R0282:Slc2a4 UTSW 11 69946355 missense probably damaging 1.00
R0709:Slc2a4 UTSW 11 69946159 missense possibly damaging 0.92
R1598:Slc2a4 UTSW 11 69945018 missense probably benign 0.00
R1800:Slc2a4 UTSW 11 69946307 missense probably benign 0.08
R1885:Slc2a4 UTSW 11 69945007 missense probably benign 0.03
R1893:Slc2a4 UTSW 11 69946572 missense probably damaging 1.00
R2439:Slc2a4 UTSW 11 69945625 missense possibly damaging 0.93
R2847:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2849:Slc2a4 UTSW 11 69946171 missense probably damaging 1.00
R2865:Slc2a4 UTSW 11 69946116 missense probably damaging 1.00
R3001:Slc2a4 UTSW 11 69945925 nonsense probably null
R3002:Slc2a4 UTSW 11 69945925 nonsense probably null
R4455:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4456:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4463:Slc2a4 UTSW 11 69943322 unclassified probably benign
R4622:Slc2a4 UTSW 11 69944774 unclassified probably benign
R4822:Slc2a4 UTSW 11 69946587 missense probably damaging 1.00
R5695:Slc2a4 UTSW 11 69946391 missense probably damaging 1.00
R6348:Slc2a4 UTSW 11 69945022 missense probably benign 0.03
R7294:Slc2a4 UTSW 11 69945399 missense probably benign 0.00
R7315:Slc2a4 UTSW 11 69946433 missense probably damaging 0.99
X0067:Slc2a4 UTSW 11 69944256 missense probably benign 0.11
Predicted Primers PCR Primer
(F):5'- GCCAATGAGGAACCGTCCAAGAATG -3'
(R):5'- GGGGTTATCAATGCCCCACAGAAG -3'

Sequencing Primer
(F):5'- CACGGCCAAGACATTGTTG -3'
(R):5'- AGGTGAGTGACCTACCAGC -3'
Posted On2013-04-16