Incidental Mutation 'R2913:Tcof1'
ID254778
Institutional Source Beutler Lab
Gene Symbol Tcof1
Ensembl Gene ENSMUSG00000024613
Gene Nametreacle ribosome biogenesis factor 1
Synonymstreacle
MMRRC Submission 040500-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2913 (G1)
Quality Score225
Status Validated
Chromosome18
Chromosomal Location60813755-60848971 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 60816084 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 1253 (D1253G)
Ref Sequence ENSEMBL: ENSMUSP00000135476 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050487] [ENSMUST00000097563] [ENSMUST00000163446] [ENSMUST00000167610] [ENSMUST00000175934] [ENSMUST00000176630] [ENSMUST00000177172]
Predicted Effect probably benign
Transcript: ENSMUST00000050487
SMART Domains Protein: ENSMUSP00000057836
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 2.8e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6e-36 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097563
SMART Domains Protein: ENSMUSP00000095171
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.3e-40 PFAM
Pfam:MHCassoc_trimer 119 190 6.7e-36 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163446
SMART Domains Protein: ENSMUSP00000130454
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 322 2.2e-8 PFAM
Pfam:Treacle 321 793 4.6e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 855 874 N/A INTRINSIC
low complexity region 879 893 N/A INTRINSIC
low complexity region 916 927 N/A INTRINSIC
low complexity region 967 977 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000167610
SMART Domains Protein: ENSMUSP00000126688
Gene: ENSMUSG00000024610

DomainStartEndE-ValueType
Pfam:MHC2-interact 1 112 5.8e-45 PFAM
Pfam:MHCassoc_trimer 119 187 1.7e-34 PFAM
TY 212 258 8.6e-18 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175586
Predicted Effect possibly damaging
Transcript: ENSMUST00000175934
AA Change: D1289G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135639
Gene: ENSMUSG00000024613
AA Change: D1289G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 153 329 1.6e-12 PFAM
Pfam:Treacle 321 792 6.1e-175 PFAM
Pfam:Treacle 782 936 3.2e-16 PFAM
low complexity region 969 982 N/A INTRINSIC
low complexity region 1025 1039 N/A INTRINSIC
low complexity region 1060 1074 N/A INTRINSIC
low complexity region 1149 1172 N/A INTRINSIC
low complexity region 1260 1285 N/A INTRINSIC
coiled coil region 1306 1335 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000176630
AA Change: D1253G

PolyPhen 2 Score 0.845 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000135476
Gene: ENSMUSG00000024613
AA Change: D1253G

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
Pfam:Treacle 108 323 2.5e-8 PFAM
Pfam:Treacle 321 793 5.9e-204 PFAM
low complexity region 819 834 N/A INTRINSIC
low complexity region 843 857 N/A INTRINSIC
low complexity region 880 891 N/A INTRINSIC
low complexity region 933 946 N/A INTRINSIC
low complexity region 989 1003 N/A INTRINSIC
low complexity region 1024 1038 N/A INTRINSIC
low complexity region 1113 1136 N/A INTRINSIC
low complexity region 1224 1249 N/A INTRINSIC
coiled coil region 1270 1299 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000177172
SMART Domains Protein: ENSMUSP00000134755
Gene: ENSMUSG00000024613

DomainStartEndE-ValueType
LisH 6 38 5.09e-4 SMART
low complexity region 75 109 N/A INTRINSIC
Pfam:Treacle 150 322 1.3e-10 PFAM
Pfam:Treacle 321 506 1.5e-78 PFAM
Pfam:Treacle 498 745 2e-105 PFAM
low complexity region 771 786 N/A INTRINSIC
low complexity region 795 809 N/A INTRINSIC
low complexity region 832 843 N/A INTRINSIC
low complexity region 885 898 N/A INTRINSIC
low complexity region 941 955 N/A INTRINSIC
low complexity region 976 990 N/A INTRINSIC
Meta Mutation Damage Score 0.0656 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.7%
Validation Efficiency 100% (58/58)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a nucleolar protein with a LIS1 homology domain. The protein is involved in ribosomal DNA gene transcription through its interaction with upstream binding factor (UBF). Mutations in this gene have been associated with Treacher Collins syndrome, a disorder which includes abnormal craniofacial development. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2008]
PHENOTYPE: Heterozygotes for a targeted null mutation die perinatally with severe craniofacial malformations including agenesis of the nasal passages, abnormal development of the maxilla, exencephaly, and anophthalmia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2410089E03Rik T C 15: 8,270,685 S3159P unknown Het
5430419D17Rik T C 7: 131,182,024 S49P possibly damaging Het
9530053A07Rik A T 7: 28,164,307 L2501F probably damaging Het
Acap2 T C 16: 31,116,069 Q357R probably damaging Het
Adap1 C T 5: 139,274,821 probably null Het
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Aldh3b1 T C 19: 3,921,275 probably benign Het
Arih2 A G 9: 108,644,076 S68P probably damaging Het
Col1a2 C T 6: 4,519,923 probably benign Het
Crocc C T 4: 141,020,350 R1496H probably damaging Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Cyp11b1 T C 15: 74,836,421 T402A probably damaging Het
Etfa C A 9: 55,482,329 A254S probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Gpr157 G A 4: 150,098,765 V131I probably benign Het
Hbb-bh1 C T 7: 103,843,047 E22K possibly damaging Het
Hmcn2 A G 2: 31,460,210 T5040A possibly damaging Het
Hprt T C X: 53,020,139 Y174H probably damaging Het
Igsf10 T A 3: 59,331,736 L341F possibly damaging Het
Ints1 A G 5: 139,757,913 S1592P possibly damaging Het
Itgam T C 7: 128,112,406 I641T probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mapk3 T A 7: 126,760,806 C19* probably null Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Med26 T G 8: 72,496,112 K381T possibly damaging Het
Mki67 T C 7: 135,700,686 E873G possibly damaging Het
Mrgpra9 T C 7: 47,235,080 I280V probably benign Het
Mroh9 T C 1: 163,044,003 Y637C probably damaging Het
Nktr T C 9: 121,749,604 probably benign Het
Olfr1052 A G 2: 86,298,389 D191G probably damaging Het
Olfr1206 A T 2: 88,865,114 N170Y probably benign Het
Pam A C 1: 97,923,129 L168R probably damaging Het
Pikfyve G A 1: 65,253,517 V1376M probably damaging Het
Pomt2 A T 12: 87,128,969 N400K probably damaging Het
Pramef12 T C 4: 144,392,734 E421G probably damaging Het
Rbm45 C T 2: 76,375,454 P217S probably benign Het
Rc3h2 A G 2: 37,378,959 S832P possibly damaging Het
Ric3 A G 7: 109,054,453 F144L possibly damaging Het
Rrh G T 3: 129,815,609 A83E probably damaging Het
Rspo2 T A 15: 43,078,114 T138S probably benign Het
Skint5 A G 4: 113,524,092 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Spata31d1d T C 13: 59,726,955 E922G possibly damaging Het
Spc25 T C 2: 69,199,987 H104R probably benign Het
Sptssa A T 12: 54,656,482 M1K probably null Het
Srrm2 G T 17: 23,815,684 probably benign Het
Tmem181c-ps A G 17: 6,621,209 noncoding transcript Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Trio T A 15: 27,854,912 Q728L probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Vwf T A 6: 125,685,846 V2731E probably benign Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Zgrf1 T C 3: 127,598,707 V1292A possibly damaging Het
Other mutations in Tcof1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00468:Tcof1 APN 18 60814568 unclassified probably benign
IGL01339:Tcof1 APN 18 60818095 utr 3 prime probably benign
IGL02072:Tcof1 APN 18 60831565 missense possibly damaging 0.85
IGL02160:Tcof1 APN 18 60848743 unclassified probably benign
IGL02513:Tcof1 APN 18 60831778 missense possibly damaging 0.51
IGL02823:Tcof1 APN 18 60816048 missense probably benign 0.00
IGL03161:Tcof1 APN 18 60833488 missense possibly damaging 0.86
IGL03291:Tcof1 APN 18 60829061 missense possibly damaging 0.71
FR4304:Tcof1 UTSW 18 60835742 unclassified probably benign
FR4589:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
FR4737:Tcof1 UTSW 18 60828650 critical splice donor site probably benign
PIT4802001:Tcof1 UTSW 18 60831938 missense unknown
R0569:Tcof1 UTSW 18 60829035 missense possibly damaging 0.85
R0602:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R0744:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0782:Tcof1 UTSW 18 60816280 missense probably damaging 0.97
R0833:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0836:Tcof1 UTSW 18 60845832 missense probably damaging 1.00
R0885:Tcof1 UTSW 18 60835850 missense possibly damaging 0.84
R1465:Tcof1 UTSW 18 60818954 splice site probably benign
R1528:Tcof1 UTSW 18 60814999 nonsense probably null
R1643:Tcof1 UTSW 18 60816228 missense possibly damaging 0.72
R1919:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R1920:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R1921:Tcof1 UTSW 18 60838855 missense possibly damaging 0.87
R2023:Tcof1 UTSW 18 60833533 missense probably damaging 1.00
R2108:Tcof1 UTSW 18 60835773 missense probably damaging 0.97
R2114:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2115:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2116:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2117:Tcof1 UTSW 18 60832785 missense possibly damaging 0.85
R2156:Tcof1 UTSW 18 60831829 missense possibly damaging 0.92
R2221:Tcof1 UTSW 18 60837901 missense possibly damaging 0.51
R2229:Tcof1 UTSW 18 60832177 intron probably benign
R2914:Tcof1 UTSW 18 60816084 missense possibly damaging 0.85
R3944:Tcof1 UTSW 18 60822837 missense probably damaging 0.98
R3979:Tcof1 UTSW 18 60831533 missense possibly damaging 0.71
R4049:Tcof1 UTSW 18 60832903 missense possibly damaging 0.84
R4125:Tcof1 UTSW 18 60819601 missense unknown
R5047:Tcof1 UTSW 18 60831914 missense possibly damaging 0.86
R5433:Tcof1 UTSW 18 60818033 utr 3 prime probably benign
R5546:Tcof1 UTSW 18 60831556 missense possibly damaging 0.85
R5832:Tcof1 UTSW 18 60819539 missense unknown
R5965:Tcof1 UTSW 18 60833418 critical splice donor site probably null
R6301:Tcof1 UTSW 18 60828825 missense probably damaging 0.97
R6480:Tcof1 UTSW 18 60814780 intron probably null
R6910:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R6911:Tcof1 UTSW 18 60829051 missense possibly damaging 0.84
R7105:Tcof1 UTSW 18 60843296 missense probably damaging 1.00
R7225:Tcof1 UTSW 18 60828448 missense unknown
R7356:Tcof1 UTSW 18 60818094 missense unknown
Predicted Primers PCR Primer
(F):5'- AACCACTTCCCAGGCTCTTG -3'
(R):5'- TGTGGTGAAGGTCCTGACAG -3'

Sequencing Primer
(F):5'- CTCTTGTTCTCTGTGGAAAGAATGAG -3'
(R):5'- CTTCTGGAGCAGGAACGG -3'
Posted On2014-12-29