Incidental Mutation 'R2914:Dbn1'
ID254815
Institutional Source Beutler Lab
Gene Symbol Dbn1
Ensembl Gene ENSMUSG00000034675
Gene Namedrebrin 1
Synonymsdrebrin A, drebrin E2
MMRRC Submission 040501-MU
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.750) question?
Stock #R2914 (G1)
Quality Score225
Status Validated
Chromosome13
Chromosomal Location55473429-55488111 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 55482421 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 45 (F45L)
Ref Sequence ENSEMBL: ENSMUSP00000122574 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021950] [ENSMUST00000109921] [ENSMUST00000109923] [ENSMUST00000139275]
Predicted Effect probably benign
Transcript: ENSMUST00000021950
AA Change: F108L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000021950
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 331 346 N/A INTRINSIC
low complexity region 453 473 N/A INTRINSIC
low complexity region 477 498 N/A INTRINSIC
low complexity region 502 518 N/A INTRINSIC
low complexity region 619 637 N/A INTRINSIC
low complexity region 655 668 N/A INTRINSIC
low complexity region 697 705 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109921
AA Change: F108L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000105547
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 610 623 N/A INTRINSIC
low complexity region 652 660 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000109923
AA Change: F108L

PolyPhen 2 Score 0.134 (Sensitivity: 0.92; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000105549
Gene: ENSMUSG00000034675
AA Change: F108L

DomainStartEndE-ValueType
ADF 8 134 2.34e-25 SMART
coiled coil region 176 256 N/A INTRINSIC
low complexity region 263 284 N/A INTRINSIC
low complexity region 407 427 N/A INTRINSIC
low complexity region 431 452 N/A INTRINSIC
low complexity region 456 472 N/A INTRINSIC
low complexity region 573 591 N/A INTRINSIC
low complexity region 609 622 N/A INTRINSIC
low complexity region 651 659 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000124480
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127867
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135705
Predicted Effect probably damaging
Transcript: ENSMUST00000139275
AA Change: F45L

PolyPhen 2 Score 0.966 (Sensitivity: 0.77; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000122574
Gene: ENSMUSG00000034675
AA Change: F45L

DomainStartEndE-ValueType
Pfam:Cofilin_ADF 1 71 9.1e-14 PFAM
coiled coil region 113 169 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139516
Predicted Effect noncoding transcript
Transcript: ENSMUST00000175813
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183653
Meta Mutation Damage Score 0.352 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency 100% (41/41)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a cytoplasmic actin-binding protein thought to play a role in the process of neuronal growth. It is a member of the drebrin family of proteins that are developmentally regulated in the brain. A decrease in the amount of this protein in the brain has been implicated as a possible contributing factor in the pathogenesis of memory disturbance in Alzheimer's disease. At least two alternative splice variants encoding different protein isoforms have been described for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele display impaired cued conditioning behavior. Mice homozygous for a different knock-out allele show altered neurotransmitter receptor levels in protein complexes, abnormal dendritic spine morphology, and impaired synaptic plasticity in the hippocampus. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrf3 A G 5: 30,196,994 S679P probably damaging Het
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Cryl1 T C 14: 57,275,918 E282G probably benign Het
Dclre1b T C 3: 103,808,114 M105V probably damaging Het
Defb12 T C 8: 19,114,814 N3D probably benign Het
Eprs G A 1: 185,379,742 probably null Het
Fa2h T C 8: 111,393,649 D35G probably damaging Het
Fdxacb1 C T 9: 50,768,399 A39V probably benign Het
Fras1 G A 5: 96,733,915 R2502K probably benign Het
Grm1 A G 10: 11,079,857 S228P probably benign Het
Il27ra T A 8: 84,031,613 probably benign Het
Lrrtm1 A T 6: 77,244,979 Q473L probably damaging Het
Macf1 T A 4: 123,475,911 I121F probably damaging Het
Mael A T 1: 166,226,610 F188I probably damaging Het
Mapk4 C T 18: 73,935,165 A232T probably benign Het
Mrpl9 C A 3: 94,443,801 T96K probably damaging Het
Musk C A 4: 58,366,938 L511I probably damaging Het
Mutyh G A 4: 116,815,629 D60N probably damaging Het
Nckap5 A T 1: 126,026,537 probably null Het
Nktr T C 9: 121,749,604 probably benign Het
Otud7b C A 3: 96,155,955 A837E probably benign Het
Pigb A T 9: 73,039,778 probably null Het
Pip4k2b G T 11: 97,722,434 N245K probably benign Het
Ptprd T A 4: 75,947,101 D1464V probably damaging Het
Rab22a A G 2: 173,695,281 N98S probably benign Het
Rictor G T 15: 6,769,995 probably null Het
Rims1 T C 1: 22,805,630 E32G probably damaging Het
Slx4ip A G 2: 137,067,591 probably null Het
Snx19 G A 9: 30,433,532 probably benign Het
Snx29 C T 16: 11,447,453 R516W probably damaging Het
Tcof1 T C 18: 60,816,084 D1253G possibly damaging Het
Tmod1 A T 4: 46,092,259 N203I probably damaging Het
Tmprss15 T C 16: 78,962,190 N880S probably benign Het
Ttn A T 2: 76,769,635 I19065N probably damaging Het
Txk T C 5: 72,724,451 N154S probably damaging Het
Utp20 A G 10: 88,754,475 probably null Het
Vmn1r65 T A 7: 6,009,041 I65F possibly damaging Het
Yes1 T C 5: 32,640,582 S82P probably benign Het
Other mutations in Dbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00849:Dbn1 APN 13 55482189 missense probably damaging 1.00
IGL01408:Dbn1 APN 13 55482304 splice site probably benign
IGL02123:Dbn1 APN 13 55476740 missense possibly damaging 0.82
R0026:Dbn1 UTSW 13 55477784 missense probably damaging 1.00
R0318:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0319:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0400:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0417:Dbn1 UTSW 13 55474916 missense probably damaging 1.00
R0765:Dbn1 UTSW 13 55482294 missense probably damaging 1.00
R0905:Dbn1 UTSW 13 55474227 unclassified probably benign
R1695:Dbn1 UTSW 13 55476708 missense probably benign 0.01
R1844:Dbn1 UTSW 13 55481347 critical splice donor site probably null
R1997:Dbn1 UTSW 13 55482441 missense probably damaging 1.00
R2912:Dbn1 UTSW 13 55482421 missense probably damaging 0.97
R4398:Dbn1 UTSW 13 55475381 missense probably benign 0.05
R4477:Dbn1 UTSW 13 55481561 small deletion probably benign
R4515:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4518:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4519:Dbn1 UTSW 13 55476229 missense possibly damaging 0.64
R4678:Dbn1 UTSW 13 55475258 missense probably benign
R4886:Dbn1 UTSW 13 55477542 unclassified probably benign
R6272:Dbn1 UTSW 13 55475104 missense probably benign 0.00
R6741:Dbn1 UTSW 13 55481537 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TGCAATACTGGGCTGGAGAG -3'
(R):5'- CACTAGTTCTTGGGAAGATAGCC -3'

Sequencing Primer
(F):5'- TGCCAGTCCATTGGAGAGC -3'
(R):5'- AGATAGCCTGGGCCCATAG -3'
Posted On2014-12-29