Mutagenetix > Incidental Mutation

Incidental Mutation 'R2916:Rps24'

254890

Institutional Source

Beutler Lab

Gene Symbol

Rps24

Ensembl Gene

ENSMUSG00000025290

Gene Name

ribosomal protein S24

Synonyms

MRP S24

Accession Numbers

Essential gene?

Probably essential (E-score: 0.840) question?

Stock #

R2916 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

24540746-24547028 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 24542009 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 23 (V23A)

Ref Sequence

ENSEMBL: ENSMUSP00000153637 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000026322] [ENSMUST00000112384] [ENSMUST00000169826] [ENSMUST00000223718] [ENSMUST00000223999] [ENSMUST00000225023] [ENSMUST00000224568]

AlphaFold

P62849

Predicted Effect

probably benign
Transcript: ENSMUST00000026322

SMART Domains

Protein: ENSMUSP00000026322
Gene: ENSMUSG00000025280

Domain	Start	End	E-Value	Type
Blast:RPOLA_N	122	218	5e-43	BLAST
RPOLA_N	248	553	1.09e-176	SMART
Pfam:RNA_pol_Rpb1_4	728	834	4e-35	PFAM
Pfam:RNA_pol_Rpb1_5	841	1318	1.2e-92	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112384
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000108003
Gene: ENSMUSG00000025290
AA Change: V35A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	23	108	4.4e-41	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000169826
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

SMART Domains

Protein: ENSMUSP00000125977
Gene: ENSMUSG00000025290
AA Change: V35A

Domain	Start	End	E-Value	Type
Pfam:Ribosomal_S24e	24	102	1.9e-48	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000223718

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223931

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000223939

Predicted Effect

probably benign
Transcript: ENSMUST00000223999
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000225023
AA Change: V35A

PolyPhen 2 Score 0.012 (Sensitivity: 0.96; Specificity: 0.78)

Predicted Effect

probably benign
Transcript: ENSMUST00000224568
AA Change: V23A

PolyPhen 2 Score 0.020 (Sensitivity: 0.95; Specificity: 0.80)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224549

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225014

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224699

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000224569

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225117

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225994

Coding Region Coverage

1x: 99.1%
3x: 98.6%
10x: 97.2%
20x: 94.9%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a ribosomal protein that is a component of the 40S subunit. The protein belongs to the S24E family of ribosomal proteins. It is located in the cytoplasm. Multiple transcript variants encoding different isoforms have been found for this gene. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. Mutations in this gene result in Diamond-Blackfan anemia. [provided by RefSeq, Nov 2008]

Allele List at MGI

Other mutations in this stock

Total: 18 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anxa13	T	C	15: 58,208,476 (GRCm39)		noncoding transcript	Het
Brd7	A	G	8: 89,069,408 (GRCm39)	I429T	probably damaging	Het
Btbd10	T	C	7: 112,932,031 (GRCm39)	M124V	probably benign	Het
Dysf	G	A	6: 84,163,491 (GRCm39)		probably null	Het
Ephb2	T	C	4: 136,411,256 (GRCm39)	D468G	probably damaging	Het
Fig4	A	G	10: 41,134,071 (GRCm39)	F404S	probably damaging	Het
Hcn3	A	G	3: 89,054,920 (GRCm39)	S776P	probably benign	Het
Hivep2	C	A	10: 14,004,713 (GRCm39)	T437K	probably benign	Het
Il17re	G	A	6: 113,442,989 (GRCm39)		probably null	Het
Mug2	A	G	6: 122,051,683 (GRCm39)		probably null	Het
Nudt9	C	A	5: 104,203,424 (GRCm39)	A121E	probably damaging	Het
Or2aa1	T	C	11: 59,480,265 (GRCm39)	T217A	probably benign	Het
Pdcd11	AGAGGAGGAGGAGGAGGAGGAGGAG	AGAGGAGGAGGAGGAGGAGGAG	19: 47,101,876 (GRCm39)		probably benign	Het
Pkdcc	G	C	17: 83,523,378 (GRCm39)	A162P	probably benign	Het
Rassf4	A	G	6: 116,618,701 (GRCm39)	V194A	probably damaging	Het
Six3	A	T	17: 85,929,061 (GRCm39)	I132F	probably benign	Het
Srsf12	C	T	4: 33,231,042 (GRCm39)	R179*	probably null	Het
Zbtb14	C	T	17: 69,695,214 (GRCm39)	P304L	probably damaging	Het

Other mutations in Rps24

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02049:Rps24	APN	14	24,541,823 (GRCm39)	missense	probably benign
R1209:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1317:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1363:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1365:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1393:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1427:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1429:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1771:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R1776:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00
R4837:Rps24	UTSW	14	24,541,855 (GRCm39)	missense	possibly damaging	0.93
R6146:Rps24	UTSW	14	24,540,803 (GRCm39)	start gained	probably null
R6249:Rps24	UTSW	14	24,543,530 (GRCm39)	missense	possibly damaging	0.92
R6386:Rps24	UTSW	14	24,542,116 (GRCm39)	missense	possibly damaging	0.79
R7316:Rps24	UTSW	14	24,540,757 (GRCm39)	unclassified	probably benign
R8402:Rps24	UTSW	14	24,540,829 (GRCm39)	splice site	probably benign
V7732:Rps24	UTSW	14	24,541,830 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TAACCATCCGGACCAGGAAG -3'
(R):5'- CTGGGATTACAGGCATGTATCC -3'

Sequencing Primer
(F):5'- GGAAGTTCATGACCAACCGTCTG -3'
(R):5'- ATAAGATACCTACTCTTGCCAGTCTG -3'

Posted On

2014-12-29