Mutagenetix > Incidental Mutation

Incidental Mutation 'R2917:Stxbp5l'

254919

Institutional Source

Beutler Lab

Gene Symbol

Stxbp5l

Ensembl Gene

ENSMUSG00000022829

Gene Name

syntaxin binding protein 5-like

Synonyms

insulin level locus 1, T2dm1, LLGL4, tomosyn-2, t2md1, A830015P08Rik

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R2917 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

36935304-37205324 bp(-) (GRCm39)

Type of Mutation

nonsense

DNA Base Change (assembly)

A to T at 37021004 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Stop codon at position 630 (L630*)

Ref Sequence

ENSEMBL: ENSMUSP00000110435 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000023526] [ENSMUST00000114780] [ENSMUST00000114781] [ENSMUST00000114782] [ENSMUST00000114787]

AlphaFold

Q5DQR4

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000023526

SMART Domains

Protein: ENSMUSP00000023526
Gene: ENSMUSG00000022829

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	2e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	7.6e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
low complexity region	790	804	N/A	INTRINSIC

Predicted Effect

probably null
Transcript: ENSMUST00000114780
AA Change: L630*

SMART Domains

Protein: ENSMUSP00000110428
Gene: ENSMUSG00000022829
AA Change: L630*

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	8.6e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	731	988	3e-9	PFAM
PDB:1URQ\|A	1038	1097	2e-25	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000114781
AA Change: L630*

SMART Domains

Protein: ENSMUSP00000110429
Gene: ENSMUSG00000022829
AA Change: L630*

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	8.9e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	755	1012	3.1e-9	PFAM
PDB:1URQ\|A	1062	1121	2e-25	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000114782
AA Change: L630*

SMART Domains

Protein: ENSMUSP00000110430
Gene: ENSMUSG00000022829
AA Change: L630*

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	284	396	9.2e-45	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	785	1045	3.1e-9	PFAM
PDB:1URQ\|A	1095	1154	2e-25	PDB

Predicted Effect

probably null
Transcript: ENSMUST00000114787
AA Change: L630*

SMART Domains

Protein: ENSMUSP00000110435
Gene: ENSMUSG00000022829
AA Change: L630*

Domain	Start	End	E-Value	Type
low complexity region	16	40	N/A	INTRINSIC
WD40	58	97	1.1e2	SMART
WD40	99	138	6.66e-1	SMART
Blast:WD40	143	182	1e-20	BLAST
WD40	197	236	2.22e0	SMART
WD40	240	277	1.7e-2	SMART
Pfam:LLGL	287	396	8.7e-35	PFAM
WD40	397	476	7.7e-1	SMART
WD40	501	541	6.14e1	SMART
low complexity region	577	592	N/A	INTRINSIC
Pfam:Lgl_C	811	1069	3.3e-9	PFAM
PDB:1URQ\|A	1119	1178	2e-25	PDB

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000149984

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.4%
20x: 95.4%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is similar to syntaxin-binding protein 5 and contains ten N-terminal WD40 repeats, four variable region WD40 repeats, and a C-terminal R-SNARE domain. Studies of the orthologous proteins in mouse and rat have shown that the encoded protein may inhibit exocytosis in neurosecretory cells, and may negatively regulate the secretion of insulin. A missense variant in this gene is likely the cause of an infantile-onset neurodegenerative disorder diagnosed in two siblings of consanguineous parents. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a QTL derived from BTBR exhibit increased fasting serum glucose and decreased fasting serum insulin. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 23 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Acsbg3	T	A	17: 57,192,141 (GRCm39)	V568E	probably damaging	Het
Ap3m2	A	G	8: 23,289,815 (GRCm39)	V96A	probably benign	Het
Bglap3	G	C	3: 88,276,819 (GRCm39)		probably benign	Het
Brd7	A	G	8: 89,069,408 (GRCm39)	I429T	probably damaging	Het
Cacna1h	A	C	17: 25,614,426 (GRCm39)	L230R	probably damaging	Het
Camta2	A	G	11: 70,571,787 (GRCm39)	F479S	probably damaging	Het
Cmya5	A	T	13: 93,227,572 (GRCm39)	Y2505*	probably null	Het
Colgalt2	T	A	1: 152,347,495 (GRCm39)	V143D	probably damaging	Het
Dnaja1	C	T	4: 40,724,052 (GRCm39)	A71V	possibly damaging	Het
Gpr33	A	G	12: 52,070,379 (GRCm39)	V220A	possibly damaging	Het
Hsph1	A	T	5: 149,554,251 (GRCm39)	L168*	probably null	Het
Lig4	T	A	8: 10,021,596 (GRCm39)	E728V	possibly damaging	Het
Mrps23	T	C	11: 88,100,743 (GRCm39)	S75P	probably damaging	Het
Or2aa1	T	C	11: 59,480,265 (GRCm39)	T217A	probably benign	Het
Or5af2	A	G	11: 58,708,314 (GRCm39)	N160S	probably damaging	Het
Prss50	G	T	9: 110,691,613 (GRCm39)	G306C	probably null	Het
Rnf149	A	T	1: 39,591,564 (GRCm39)	S392T	probably benign	Het
Scn8a	T	A	15: 100,937,613 (GRCm39)	F1661I	probably damaging	Het
Slc12a8	T	A	16: 33,371,296 (GRCm39)	I144N	probably damaging	Het
Tmem131l	G	A	3: 83,844,887 (GRCm39)	R441*	probably null	Het
Trim63	T	C	4: 134,050,462 (GRCm39)	Y249H	probably damaging	Het
Vmn2r125	T	G	4: 156,703,564 (GRCm39)	L314R	probably benign	Het
Vwf	A	G	6: 125,585,106 (GRCm39)	N663D	probably benign	Het

Other mutations in Stxbp5l

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00836:Stxbp5l	APN	16	37,028,462 (GRCm39)	missense	possibly damaging	0.82
IGL01082:Stxbp5l	APN	16	37,024,940 (GRCm39)	missense	possibly damaging	0.89
IGL01448:Stxbp5l	APN	16	37,036,341 (GRCm39)	missense	probably damaging	0.99
IGL01475:Stxbp5l	APN	16	37,165,454 (GRCm39)	missense	possibly damaging	0.95
IGL01899:Stxbp5l	APN	16	37,020,954 (GRCm39)	missense	probably benign	0.19
IGL02232:Stxbp5l	APN	16	37,150,257 (GRCm39)	missense	probably damaging	1.00
IGL02389:Stxbp5l	APN	16	37,028,567 (GRCm39)	missense	probably benign	0.00
IGL02745:Stxbp5l	APN	16	37,007,016 (GRCm39)	nonsense	probably null
IGL03125:Stxbp5l	APN	16	37,007,083 (GRCm39)	missense	probably benign	0.02
R0058:Stxbp5l	UTSW	16	36,962,736 (GRCm39)	missense	possibly damaging	0.76
R0345:Stxbp5l	UTSW	16	37,108,670 (GRCm39)	missense	probably damaging	1.00
R0359:Stxbp5l	UTSW	16	37,036,440 (GRCm39)	splice site	probably benign
R0454:Stxbp5l	UTSW	16	36,954,646 (GRCm39)	missense	possibly damaging	0.94
R0525:Stxbp5l	UTSW	16	36,950,159 (GRCm39)	critical splice donor site	probably null
R0543:Stxbp5l	UTSW	16	37,028,458 (GRCm39)	missense	probably damaging	1.00
R0606:Stxbp5l	UTSW	16	37,024,883 (GRCm39)	missense	possibly damaging	0.46
R0607:Stxbp5l	UTSW	16	36,962,794 (GRCm39)	missense	probably benign	0.00
R1333:Stxbp5l	UTSW	16	37,068,231 (GRCm39)	critical splice donor site	probably null
R1593:Stxbp5l	UTSW	16	36,936,414 (GRCm39)	missense	probably damaging	0.96
R1605:Stxbp5l	UTSW	16	37,028,473 (GRCm39)	missense	probably benign	0.34
R1670:Stxbp5l	UTSW	16	37,111,289 (GRCm39)	critical splice donor site	probably null
R2077:Stxbp5l	UTSW	16	37,056,637 (GRCm39)	missense	possibly damaging	0.93
R2209:Stxbp5l	UTSW	16	37,036,398 (GRCm39)	missense	probably damaging	0.98
R2504:Stxbp5l	UTSW	16	36,936,029 (GRCm39)	missense	probably damaging	1.00
R2909:Stxbp5l	UTSW	16	37,028,548 (GRCm39)	missense	possibly damaging	0.89
R2918:Stxbp5l	UTSW	16	37,021,004 (GRCm39)	nonsense	probably null
R2935:Stxbp5l	UTSW	16	36,954,551 (GRCm39)	missense	possibly damaging	0.76
R3693:Stxbp5l	UTSW	16	37,061,708 (GRCm39)	nonsense	probably null
R3694:Stxbp5l	UTSW	16	37,061,708 (GRCm39)	nonsense	probably null
R3695:Stxbp5l	UTSW	16	37,061,708 (GRCm39)	nonsense	probably null
R4133:Stxbp5l	UTSW	16	37,028,481 (GRCm39)	missense	possibly damaging	0.80
R4180:Stxbp5l	UTSW	16	37,068,242 (GRCm39)	missense	probably benign	0.05
R4676:Stxbp5l	UTSW	16	37,076,246 (GRCm39)	missense	probably damaging	1.00
R4757:Stxbp5l	UTSW	16	37,008,996 (GRCm39)	missense	probably damaging	1.00
R4758:Stxbp5l	UTSW	16	36,954,592 (GRCm39)	missense	probably benign	0.18
R5105:Stxbp5l	UTSW	16	36,962,734 (GRCm39)	missense	probably benign	0.43
R5278:Stxbp5l	UTSW	16	37,007,016 (GRCm39)	missense	probably benign	0.19
R5358:Stxbp5l	UTSW	16	36,994,688 (GRCm39)	missense	probably damaging	0.99
R5411:Stxbp5l	UTSW	16	36,950,213 (GRCm39)	missense	probably damaging	1.00
R5773:Stxbp5l	UTSW	16	37,028,459 (GRCm39)	missense	probably damaging	1.00
R6539:Stxbp5l	UTSW	16	36,950,177 (GRCm39)	missense	probably damaging	1.00
R6869:Stxbp5l	UTSW	16	37,024,810 (GRCm39)	missense	possibly damaging	0.74
R6892:Stxbp5l	UTSW	16	37,008,991 (GRCm39)	missense	possibly damaging	0.94
R7369:Stxbp5l	UTSW	16	36,954,703 (GRCm39)	missense	probably benign	0.12
R7555:Stxbp5l	UTSW	16	37,143,965 (GRCm39)	missense	probably damaging	1.00
R7657:Stxbp5l	UTSW	16	37,030,534 (GRCm39)	missense	probably null	0.21
R8171:Stxbp5l	UTSW	16	37,028,416 (GRCm39)	missense	noncoding transcript
R8338:Stxbp5l	UTSW	16	36,994,718 (GRCm39)	missense	probably damaging	1.00
R8732:Stxbp5l	UTSW	16	37,061,809 (GRCm39)	missense	probably benign
R8833:Stxbp5l	UTSW	16	37,024,814 (GRCm39)	missense	probably benign	0.44
R8883:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R8898:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R8899:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R8906:Stxbp5l	UTSW	16	37,028,526 (GRCm39)	missense	probably damaging	1.00
R8918:Stxbp5l	UTSW	16	36,954,892 (GRCm39)	missense
R8959:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R8961:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R8989:Stxbp5l	UTSW	16	37,036,414 (GRCm39)	frame shift	probably null
R9027:Stxbp5l	UTSW	16	37,165,473 (GRCm39)	missense	probably damaging	1.00
R9044:Stxbp5l	UTSW	16	37,024,930 (GRCm39)	missense	possibly damaging	0.77
R9226:Stxbp5l	UTSW	16	37,076,206 (GRCm39)	missense	probably damaging	0.96
R9284:Stxbp5l	UTSW	16	37,028,442 (GRCm39)	nonsense	probably null
R9351:Stxbp5l	UTSW	16	36,936,047 (GRCm39)	missense	probably damaging	1.00
R9425:Stxbp5l	UTSW	16	36,994,706 (GRCm39)	missense	possibly damaging	0.83
R9545:Stxbp5l	UTSW	16	37,028,625 (GRCm39)	critical splice acceptor site	probably null
R9567:Stxbp5l	UTSW	16	37,061,734 (GRCm39)	missense	probably benign	0.37
R9616:Stxbp5l	UTSW	16	37,036,314 (GRCm39)	missense	probably damaging	1.00
R9781:Stxbp5l	UTSW	16	37,165,485 (GRCm39)	missense	probably benign	0.38
Z1088:Stxbp5l	UTSW	16	37,024,851 (GRCm39)	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- TGAAAGCAAACACCACTGGTAG -3'
(R):5'- AGCATTGTCTATCCACATACTTGC -3'

Sequencing Primer
(F):5'- ACTGGTAGATCTACTATCACATTAGC -3'
(R):5'- TGCCCCCATGTTATATATTTTTGAAG -3'

Posted On

2014-12-29