Mutagenetix > Incidental Mutation

Incidental Mutation 'R2928:Cpd'

254934

Institutional Source

Beutler Lab

Gene Symbol

Cpd

Ensembl Gene

ENSMUSG00000020841

Gene Name

carboxypeptidase D

Synonyms

D830034L15Rik

Accession Numbers

Essential gene?

Probably essential (E-score: 0.928) question?

Stock #

R2928 (G1)

Quality Score

214

Status

Not validated

Chromosome

Chromosomal Location

76669250-76737844 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 76737200 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 198 (D198G)

Ref Sequence

ENSEMBL: ENSMUSP00000021201 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000021201]

AlphaFold

O89001

Predicted Effect

probably benign
Transcript: ENSMUST00000021201
AA Change: D198G

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000021201
Gene: ENSMUSG00000020841
AA Change: D198G

Domain	Start	End	E-Value	Type
signal peptide	1	37	N/A	INTRINSIC
Zn_pept	62	471	1.71e-52	SMART
Zn_pept	502	900	2.11e-66	SMART
Zn_pept	930	1195	1.11e-42	SMART
Pfam:CarboxypepD_reg	1211	1284	3.6e-10	PFAM
transmembrane domain	1297	1319	N/A	INTRINSIC
low complexity region	1363	1371	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.6%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The metallocarboxypeptidase family of enzymes is divided into 2 subfamilies based on sequence similarities. The pancreatic carboxypeptidase-like and the regulatory B-type carboxypeptidase subfamilies. Carboxypeptidase D has been identified as a regulatory B-type carboxypeptidase. CPD is a homolog of duck gp180, a hepatitis B virus-binding protein. Transcript variants utilizing alternative polyadenylation signals exist for this gene. [provided by RefSeq, Jul 2008]

Allele List at MGI

Other mutations in this stock

Total: 11 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Anapc1	T	C	2: 128,522,057 (GRCm39)	K167R	probably damaging	Het
Brpf1	T	C	6: 113,299,007 (GRCm39)	V1127A	possibly damaging	Het
Cept1	G	A	3: 106,438,468 (GRCm39)	T205I	probably benign	Het
Csad	A	G	15: 102,086,139 (GRCm39)	F464S	probably damaging	Het
Fcrl1	A	G	3: 87,298,564 (GRCm39)	N353S	probably benign	Het
Glb1l2	A	T	9: 26,679,722 (GRCm39)	M410K	probably benign	Het
Gskip	T	A	12: 105,667,002 (GRCm39)	F127I	probably damaging	Het
Iqgap2	T	C	13: 95,818,744 (GRCm39)	T671A	probably benign	Het
Or5aq7	A	T	2: 86,938,107 (GRCm39)	I208N	possibly damaging	Het
Tmem260	T	C	14: 48,724,207 (GRCm39)	F352L	probably damaging	Het
Vmn2r22	T	C	6: 123,614,402 (GRCm39)	N396S	probably damaging	Het

Other mutations in Cpd

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00226:Cpd	APN	11	76,688,615 (GRCm39)	missense	probably benign	0.00
IGL00698:Cpd	APN	11	76,731,270 (GRCm39)	missense	possibly damaging	0.82
IGL01025:Cpd	APN	11	76,686,439 (GRCm39)	missense	probably damaging	1.00
IGL01292:Cpd	APN	11	76,737,071 (GRCm39)	missense	possibly damaging	0.80
IGL01571:Cpd	APN	11	76,673,122 (GRCm39)	missense	probably damaging	1.00
IGL01606:Cpd	APN	11	76,703,466 (GRCm39)	missense	probably benign
IGL02283:Cpd	APN	11	76,731,251 (GRCm39)	missense	probably benign	0.19
IGL02895:Cpd	APN	11	76,676,029 (GRCm39)	missense	probably benign	0.06
IGL02965:Cpd	APN	11	76,681,814 (GRCm39)	splice site	probably benign
IGL03116:Cpd	APN	11	76,702,539 (GRCm39)	missense	probably damaging	1.00
IGL03178:Cpd	APN	11	76,696,877 (GRCm39)	missense	probably benign	0.02
PIT4280001:Cpd	UTSW	11	76,681,850 (GRCm39)	missense	probably benign	0.23
PIT4382001:Cpd	UTSW	11	76,688,614 (GRCm39)	missense	probably benign
R0050:Cpd	UTSW	11	76,683,685 (GRCm39)	missense	possibly damaging	0.94
R0054:Cpd	UTSW	11	76,681,664 (GRCm39)	missense	probably damaging	1.00
R0054:Cpd	UTSW	11	76,681,664 (GRCm39)	missense	probably damaging	1.00
R0320:Cpd	UTSW	11	76,731,273 (GRCm39)	missense	possibly damaging	0.50
R0416:Cpd	UTSW	11	76,676,030 (GRCm39)	missense	probably benign	0.13
R0556:Cpd	UTSW	11	76,693,171 (GRCm39)	splice site	probably benign
R0666:Cpd	UTSW	11	76,673,153 (GRCm39)	missense	probably damaging	1.00
R0668:Cpd	UTSW	11	76,675,224 (GRCm39)	missense	probably damaging	1.00
R1180:Cpd	UTSW	11	76,692,579 (GRCm39)	missense	possibly damaging	0.56
R1472:Cpd	UTSW	11	76,675,224 (GRCm39)	missense	probably damaging	0.98
R1518:Cpd	UTSW	11	76,731,212 (GRCm39)	critical splice donor site	probably null
R1617:Cpd	UTSW	11	76,737,495 (GRCm39)	missense	probably damaging	1.00
R1786:Cpd	UTSW	11	76,683,624 (GRCm39)	missense	probably benign	0.00
R1854:Cpd	UTSW	11	76,677,164 (GRCm39)	missense	probably damaging	1.00
R1861:Cpd	UTSW	11	76,675,208 (GRCm39)	splice site	probably benign
R2159:Cpd	UTSW	11	76,688,467 (GRCm39)	missense	probably damaging	0.96
R2205:Cpd	UTSW	11	76,693,070 (GRCm39)	missense	probably damaging	0.99
R2281:Cpd	UTSW	11	76,688,627 (GRCm39)	missense	probably benign	0.00
R2680:Cpd	UTSW	11	76,681,825 (GRCm39)	missense	probably benign
R2937:Cpd	UTSW	11	76,702,685 (GRCm39)	missense	probably damaging	1.00
R4133:Cpd	UTSW	11	76,705,644 (GRCm39)	nonsense	probably null
R4241:Cpd	UTSW	11	76,737,611 (GRCm39)	missense	probably benign	0.03
R4369:Cpd	UTSW	11	76,688,537 (GRCm39)	missense	possibly damaging	0.82
R4538:Cpd	UTSW	11	76,681,825 (GRCm39)	missense	probably benign
R4551:Cpd	UTSW	11	76,702,712 (GRCm39)	missense	probably damaging	1.00
R4617:Cpd	UTSW	11	76,731,441 (GRCm39)	missense	probably damaging	1.00
R4732:Cpd	UTSW	11	76,702,620 (GRCm39)	missense	probably damaging	0.99
R4733:Cpd	UTSW	11	76,702,620 (GRCm39)	missense	probably damaging	0.99
R4821:Cpd	UTSW	11	76,737,063 (GRCm39)	missense	probably benign	0.38
R4852:Cpd	UTSW	11	76,675,976 (GRCm39)	missense	probably benign	0.32
R4901:Cpd	UTSW	11	76,681,707 (GRCm39)	missense	probably damaging	1.00
R4988:Cpd	UTSW	11	76,705,656 (GRCm39)	missense	probably damaging	0.98
R4999:Cpd	UTSW	11	76,737,048 (GRCm39)	critical splice donor site	probably null
R5005:Cpd	UTSW	11	76,704,396 (GRCm39)	missense	probably damaging	1.00
R5092:Cpd	UTSW	11	76,702,530 (GRCm39)	missense	possibly damaging	0.75
R5438:Cpd	UTSW	11	76,682,792 (GRCm39)	missense	possibly damaging	0.65
R5524:Cpd	UTSW	11	76,688,727 (GRCm39)	nonsense	probably null
R5677:Cpd	UTSW	11	76,690,651 (GRCm39)	missense	probably benign
R5826:Cpd	UTSW	11	76,675,242 (GRCm39)	nonsense	probably null
R6031:Cpd	UTSW	11	76,681,714 (GRCm39)	missense	probably benign	0.00
R6031:Cpd	UTSW	11	76,681,714 (GRCm39)	missense	probably benign	0.00
R6103:Cpd	UTSW	11	76,690,625 (GRCm39)	missense	probably benign	0.00
R6257:Cpd	UTSW	11	76,703,496 (GRCm39)	missense	probably benign	0.37
R6263:Cpd	UTSW	11	76,737,097 (GRCm39)	missense	probably benign	0.00
R6485:Cpd	UTSW	11	76,699,533 (GRCm39)	splice site	probably null
R6671:Cpd	UTSW	11	76,686,359 (GRCm39)	missense	probably damaging	1.00
R6995:Cpd	UTSW	11	76,675,881 (GRCm39)	missense	probably benign	0.02
R7074:Cpd	UTSW	11	76,704,420 (GRCm39)	missense	probably damaging	1.00
R7192:Cpd	UTSW	11	76,705,667 (GRCm39)	missense	probably damaging	1.00
R7341:Cpd	UTSW	11	76,737,779 (GRCm39)	missense	unknown
R7371:Cpd	UTSW	11	76,737,437 (GRCm39)	missense	probably benign	0.25
R7380:Cpd	UTSW	11	76,693,151 (GRCm39)	nonsense	probably null
R7392:Cpd	UTSW	11	76,692,605 (GRCm39)	missense	probably damaging	1.00
R7410:Cpd	UTSW	11	76,673,134 (GRCm39)	missense	probably damaging	1.00
R7509:Cpd	UTSW	11	76,688,702 (GRCm39)	missense	probably benign	0.17
R7767:Cpd	UTSW	11	76,704,385 (GRCm39)	missense	probably benign	0.03
R8935:Cpd	UTSW	11	76,731,295 (GRCm39)	missense	probably damaging	1.00
R9151:Cpd	UTSW	11	76,675,275 (GRCm39)	missense	possibly damaging	0.54
R9172:Cpd	UTSW	11	76,675,252 (GRCm39)	missense	probably benign	0.21
R9173:Cpd	UTSW	11	76,699,649 (GRCm39)	missense	probably damaging	0.97
R9310:Cpd	UTSW	11	76,705,607 (GRCm39)	nonsense	probably null
R9666:Cpd	UTSW	11	76,693,133 (GRCm39)	missense	probably benign	0.02
Z1088:Cpd	UTSW	11	76,692,572 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCTGTCAAAATAAGCCTCCTG -3'
(R):5'- GAAGCTGGTGGGTAACATGC -3'

Sequencing Primer
(F):5'- TCACGTGGGACCGAAAGC -3'
(R):5'- TGGGTAACATGCACGGC -3'

Posted On

2014-12-29