Incidental Mutation 'R2928:Csad'
ID254938
Institutional Source Beutler Lab
Gene Symbol Csad
Ensembl Gene ENSMUSG00000023044
Gene Namecysteine sulfinic acid decarboxylase
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2928 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location102176999-102204724 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 102177704 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 464 (F464S)
Ref Sequence ENSEMBL: ENSMUSP00000023805 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023805] [ENSMUST00000230288] [ENSMUST00000230322] [ENSMUST00000230708] [ENSMUST00000231048]
Predicted Effect probably damaging
Transcript: ENSMUST00000023805
AA Change: F464S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000023805
Gene: ENSMUSG00000023044
AA Change: F464S

DomainStartEndE-ValueType
Pfam:Pyridoxal_deC 49 417 1.4e-113 PFAM
Pfam:Aminotran_5 120 281 4.9e-7 PFAM
low complexity region 482 490 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230253
Predicted Effect probably damaging
Transcript: ENSMUST00000230288
AA Change: F434S

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Predicted Effect probably benign
Transcript: ENSMUST00000230322
Predicted Effect probably benign
Transcript: ENSMUST00000230342
Predicted Effect probably benign
Transcript: ENSMUST00000230708
Predicted Effect unknown
Transcript: ENSMUST00000231029
AA Change: F77S
Predicted Effect probably benign
Transcript: ENSMUST00000231048
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the group 2 decarboxylase family. A similar protein in rodents plays a role in multiple biological processes as the rate-limiting enzyme in taurine biosynthesis, catalyzing the decarboxylation of cysteinesulfinate to hypotaurine. Alternatively spliced transcript variants encoding multiple isoforms have been observed for this gene. [provided by RefSeq, Sep 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit neonatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 11 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anapc1 T C 2: 128,680,137 K167R probably damaging Het
Brpf1 T C 6: 113,322,046 V1127A possibly damaging Het
Cept1 G A 3: 106,531,152 T205I probably benign Het
Cpd T C 11: 76,846,374 D198G probably benign Het
Fcrl1 A G 3: 87,391,257 N353S probably benign Het
Glb1l2 A T 9: 26,768,426 M410K probably benign Het
Gskip T A 12: 105,700,743 F127I probably damaging Het
Iqgap2 T C 13: 95,682,236 T671A probably benign Het
Olfr259 A T 2: 87,107,763 I208N possibly damaging Het
Tmem260 T C 14: 48,486,750 F352L probably damaging Het
Vmn2r22 T C 6: 123,637,443 N396S probably damaging Het
Other mutations in Csad
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01563:Csad APN 15 102187163 missense probably damaging 1.00
IGL01769:Csad APN 15 102180081 missense probably benign 0.02
IGL02254:Csad APN 15 102186437 nonsense probably null
dejavu UTSW 15 102179972 missense probably damaging 1.00
dell UTSW 15 102178606 missense probably damaging 1.00
lenovo UTSW 15 102179034 missense probably null 1.00
PIT4382001:Csad UTSW 15 102188650 missense probably benign 0.00
R0701:Csad UTSW 15 102179136 missense probably benign 0.42
R1595:Csad UTSW 15 102177782 missense probably damaging 1.00
R1707:Csad UTSW 15 102179972 missense probably damaging 1.00
R2107:Csad UTSW 15 102179034 missense probably null 1.00
R2196:Csad UTSW 15 102187593 missense probably benign 0.00
R2275:Csad UTSW 15 102187122 missense probably damaging 0.98
R2504:Csad UTSW 15 102188667 start codon destroyed probably null 0.97
R3924:Csad UTSW 15 102178556 missense probably benign 0.05
R6235:Csad UTSW 15 102178606 missense probably damaging 1.00
R6418:Csad UTSW 15 102179523 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- ACAGCCAATACTTAGCTGGGAG -3'
(R):5'- GGCCACTCAGGTTACATGTG -3'

Sequencing Primer
(F):5'- CCAATACTTAGCTGGGAGAGTGAGTG -3'
(R):5'- CCACTCAGGTTACATGTGGTGGG -3'
Posted On2014-12-29