Incidental Mutation 'R2929:4921507P07Rik'
ID254945
Institutional Source Beutler Lab
Gene Symbol 4921507P07Rik
Ensembl Gene ENSMUSG00000029828
Gene NameRIKEN cDNA 4921507P07 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2929 (G1)
Quality Score225
Status Not validated
Chromosome6
Chromosomal Location50573302-50596632 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 50574305 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Isoleucine at position 388 (T388I)
Ref Sequence ENSEMBL: ENSMUSP00000031852 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031852]
Predicted Effect probably benign
Transcript: ENSMUST00000031852
AA Change: T388I

PolyPhen 2 Score 0.066 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000031852
Gene: ENSMUSG00000029828
AA Change: T388I

DomainStartEndE-ValueType
Pfam:DUF4555 1 283 2e-149 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126537
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147260
Predicted Effect noncoding transcript
Transcript: ENSMUST00000184470
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd177 G A 7: 24,754,279 Q396* probably null Het
Cdadc1 A T 14: 59,597,835 M1K probably null Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Cnnm3 T A 1: 36,524,059 F701L possibly damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Dennd4a T C 9: 64,852,417 V268A possibly damaging Het
Deup1 C T 9: 15,575,188 V399I probably benign Het
Dscam T A 16: 96,685,412 Q1021L possibly damaging Het
Dst A T 1: 34,167,062 K932* probably null Het
Neurl2 T C 2: 164,833,344 N33D possibly damaging Het
Pnmal2 T C 7: 16,946,692 S534P possibly damaging Het
Pole2 G A 12: 69,209,938 T271M probably benign Het
Ppfibp2 A G 7: 107,697,651 M191V probably damaging Het
Rad51ap2 A G 12: 11,457,184 Q369R probably benign Het
Rbm45 A G 2: 76,378,419 I300V probably benign Het
Sco1 T A 11: 67,063,922 I251K probably damaging Het
Trove2 G A 1: 143,757,878 A494V possibly damaging Het
Zfp202 T C 9: 40,211,688 V582A possibly damaging Het
Zfp219 T A 14: 52,008,979 E230D probably benign Het
Other mutations in 4921507P07Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00852:4921507P07Rik APN 6 50589184 critical splice acceptor site probably null
IGL01310:4921507P07Rik APN 6 50574195 missense probably benign
IGL01568:4921507P07Rik APN 6 50573698 utr 3 prime probably benign
IGL01794:4921507P07Rik APN 6 50577846 missense probably damaging 1.00
IGL02718:4921507P07Rik APN 6 50584387 missense probably damaging 1.00
IGL03146:4921507P07Rik APN 6 50573873 missense probably damaging 0.97
IGL03381:4921507P07Rik APN 6 50589136 missense probably damaging 1.00
R1173:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1174:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1175:4921507P07Rik UTSW 6 50589141 missense probably damaging 0.98
R1769:4921507P07Rik UTSW 6 50591821 splice site probably benign
R1883:4921507P07Rik UTSW 6 50574453 missense probably benign 0.01
R2056:4921507P07Rik UTSW 6 50573745 missense possibly damaging 0.71
R2437:4921507P07Rik UTSW 6 50583979 missense probably damaging 1.00
R4357:4921507P07Rik UTSW 6 50574210 missense probably benign
R4666:4921507P07Rik UTSW 6 50595828 missense possibly damaging 0.69
R4791:4921507P07Rik UTSW 6 50595837 missense probably damaging 1.00
R4827:4921507P07Rik UTSW 6 50595856 missense possibly damaging 0.76
R4976:4921507P07Rik UTSW 6 50589184 critical splice acceptor site probably null
R5453:4921507P07Rik UTSW 6 50595796 critical splice donor site probably null
R6689:4921507P07Rik UTSW 6 50589109 critical splice donor site probably null
R6897:4921507P07Rik UTSW 6 50589165 missense possibly damaging 0.82
X0021:4921507P07Rik UTSW 6 50573926 missense probably benign
Predicted Primers PCR Primer
(F):5'- CGGTAGGCAGACTTAAGTGG -3'
(R):5'- CCTTTGGATGGTCGAATTGCC -3'

Sequencing Primer
(F):5'- AGGCAGACTTAAGTGGTTCATAGTC -3'
(R):5'- CGAATTGCCCGACTTACTCAG -3'
Posted On2014-12-29