Incidental Mutation 'R2929:Pole2'
ID254956
Institutional Source Beutler Lab
Gene Symbol Pole2
Ensembl Gene ENSMUSG00000020974
Gene Namepolymerase (DNA directed), epsilon 2 (p59 subunit)
SynonymsDNA polymerase epsilon small subunit
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2929 (G1)
Quality Score222
Status Not validated
Chromosome12
Chromosomal Location69201773-69228195 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 69209938 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Methionine at position 271 (T271M)
Ref Sequence ENSEMBL: ENSMUSP00000152262 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021359] [ENSMUST00000221411]
Predicted Effect probably benign
Transcript: ENSMUST00000021359
AA Change: T271M

PolyPhen 2 Score 0.044 (Sensitivity: 0.94; Specificity: 0.83)
SMART Domains Protein: ENSMUSP00000021359
Gene: ENSMUSG00000020974
AA Change: T271M

DomainStartEndE-ValueType
Pfam:Dpoe2NT 2 74 1.9e-32 PFAM
Pfam:DNA_pol_E_B 287 489 1.4e-58 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000221411
AA Change: T271M

PolyPhen 2 Score 0.128 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221806
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.3%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA polymerase epsilon, which is involved in DNA repair and replication, is composed of a large catalytic subunit and a small accessory subunit. The protein encoded by this gene represents the small subunit (B). Defects in this gene have been linked to colorectal cancer and to combined immunodeficiency. [provided by RefSeq, Jan 2017]
Allele List at MGI
Other mutations in this stock
Total: 19 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4921507P07Rik G A 6: 50,574,305 T388I probably benign Het
Cd177 G A 7: 24,754,279 Q396* probably null Het
Cdadc1 A T 14: 59,597,835 M1K probably null Het
Cdc23 ACC AC 18: 34,637,318 probably null Het
Cnnm3 T A 1: 36,524,059 F701L possibly damaging Het
Cul7 C G 17: 46,651,600 D52E probably benign Het
Dennd4a T C 9: 64,852,417 V268A possibly damaging Het
Deup1 C T 9: 15,575,188 V399I probably benign Het
Dscam T A 16: 96,685,412 Q1021L possibly damaging Het
Dst A T 1: 34,167,062 K932* probably null Het
Neurl2 T C 2: 164,833,344 N33D possibly damaging Het
Pnmal2 T C 7: 16,946,692 S534P possibly damaging Het
Ppfibp2 A G 7: 107,697,651 M191V probably damaging Het
Rad51ap2 A G 12: 11,457,184 Q369R probably benign Het
Rbm45 A G 2: 76,378,419 I300V probably benign Het
Sco1 T A 11: 67,063,922 I251K probably damaging Het
Trove2 G A 1: 143,757,878 A494V possibly damaging Het
Zfp202 T C 9: 40,211,688 V582A possibly damaging Het
Zfp219 T A 14: 52,008,979 E230D probably benign Het
Other mutations in Pole2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00930:Pole2 APN 12 69226445 splice site probably benign
IGL00940:Pole2 APN 12 69215360 missense probably damaging 1.00
IGL01593:Pole2 APN 12 69223099 splice site probably null
IGL01609:Pole2 APN 12 69207857 critical splice donor site probably null
IGL01717:Pole2 APN 12 69213849 missense probably damaging 1.00
IGL02168:Pole2 APN 12 69201886 unclassified probably benign
IGL02208:Pole2 APN 12 69223162 missense possibly damaging 0.91
IGL02966:Pole2 APN 12 69209875 missense probably damaging 1.00
PIT4504001:Pole2 UTSW 12 69209985 nonsense probably null
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0069:Pole2 UTSW 12 69209887 missense probably damaging 1.00
R0396:Pole2 UTSW 12 69222386 splice site probably benign
R0574:Pole2 UTSW 12 69211457 splice site probably benign
R0620:Pole2 UTSW 12 69209879 missense probably damaging 1.00
R0685:Pole2 UTSW 12 69211413 missense probably damaging 0.98
R0791:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1452:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1453:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1455:Pole2 UTSW 12 69207929 missense probably benign 0.06
R1912:Pole2 UTSW 12 69209990 missense probably damaging 0.99
R2067:Pole2 UTSW 12 69228152 missense probably benign 0.01
R3016:Pole2 UTSW 12 69222062 missense probably benign 0.14
R4504:Pole2 UTSW 12 69222468 missense probably benign 0.00
R4765:Pole2 UTSW 12 69222052 missense possibly damaging 0.49
R4790:Pole2 UTSW 12 69226365 missense probably benign 0.00
R4896:Pole2 UTSW 12 69223150 missense probably damaging 0.97
R6998:Pole2 UTSW 12 69213906 missense possibly damaging 0.82
R7257:Pole2 UTSW 12 69202910 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTTTAACTGTGAAAGCTTTGGC -3'
(R):5'- AGGCAACATGTTTCATCTCTGG -3'

Sequencing Primer
(F):5'- GTCTCAGGTTCCCATGTAACAGG -3'
(R):5'- GGCAACATGTTTCATCTCTGGAATAC -3'
Posted On2014-12-29