Incidental Mutation 'R2932:Nipal1'
List |< first << previous [record 16 of 21] next >> last >|
ID254968
Institutional Source Beutler Lab
Gene Symbol Nipal1
Ensembl Gene ENSMUSG00000067219
Gene NameNIPA-like domain containing 1
Synonyms3830408G10Rik, Npal1
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.238) question?
Stock #R2932 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location72647795-72671078 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 72667635 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 224 (I224V)
Ref Sequence ENSEMBL: ENSMUSP00000084462 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087212] [ENSMUST00000197837]
Predicted Effect possibly damaging
Transcript: ENSMUST00000087212
AA Change: I224V

PolyPhen 2 Score 0.463 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000084462
Gene: ENSMUSG00000067219
AA Change: I224V

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 66 360 6e-136 PFAM
Pfam:EamA 107 186 1.6e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000197837
SMART Domains Protein: ENSMUSP00000143667
Gene: ENSMUSG00000067219

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 3 96 2.1e-45 PFAM
Pfam:EamA 17 96 2.8e-10 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Arpp21 T C 9: 112,179,105 D106G probably damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lor AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC 3: 92,081,878 probably benign Het
Lrrc1 T A 9: 77,457,439 H153L probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mrgprb2 A G 7: 48,552,446 L177S probably benign Het
Mtmr2 A T 9: 13,749,117 probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Nipal1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00425:Nipal1 APN 5 72658724 missense probably benign
IGL01894:Nipal1 APN 5 72663539 missense probably benign 0.02
IGL01962:Nipal1 APN 5 72668058 missense possibly damaging 0.50
IGL02145:Nipal1 APN 5 72666931 missense probably damaging 1.00
IGL02902:Nipal1 APN 5 72668062 missense possibly damaging 0.49
IGL02934:Nipal1 APN 5 72647907 missense probably damaging 1.00
IGL03024:Nipal1 APN 5 72663625 critical splice donor site probably null
IGL03237:Nipal1 APN 5 72666807 missense probably damaging 0.99
R0848:Nipal1 UTSW 5 72667840 missense probably damaging 0.99
R1024:Nipal1 UTSW 5 72667991 frame shift probably null
R2106:Nipal1 UTSW 5 72663559 missense probably damaging 0.99
R2883:Nipal1 UTSW 5 72667730 missense probably damaging 1.00
R5364:Nipal1 UTSW 5 72667900 missense probably damaging 1.00
R6175:Nipal1 UTSW 5 72663555 missense probably damaging 1.00
R6523:Nipal1 UTSW 5 72667608 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- TCCAGATTCAAAGAGTGTTTGTGG -3'
(R):5'- AGTGCAAGCATGGTCAACAG -3'

Sequencing Primer
(F):5'- GTTCTATGAAATCACTAAGGAGCAG -3'
(R):5'- CAGGATGAAGAACAGGGGATCCTTG -3'
Posted On2014-12-29