Incidental Mutation 'R2932:Mrgprb2'
ID254971
Institutional Source Beutler Lab
Gene Symbol Mrgprb2
Ensembl Gene ENSMUSG00000050425
Gene NameMAS-related GPR, member B2
Synonyms4833406I20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.109) question?
Stock #R2932 (G1)
Quality Score225
Status Not validated
Chromosome7
Chromosomal Location48550965-48558086 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 48552446 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 177 (L177S)
Ref Sequence ENSEMBL: ENSMUSP00000061878 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052730]
Predicted Effect probably benign
Transcript: ENSMUST00000052730
AA Change: L177S

PolyPhen 2 Score 0.168 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000061878
Gene: ENSMUSG00000050425
AA Change: L177S

DomainStartEndE-ValueType
Pfam:7tm_1 54 286 2.1e-7 PFAM
low complexity region 293 308 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit impaired mast cell activation and inflammatory response after 48/80 treatment. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Arpp21 T C 9: 112,179,105 D106G probably damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lor AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC 3: 92,081,878 probably benign Het
Lrrc1 T A 9: 77,457,439 H153L probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mtmr2 A T 9: 13,749,117 probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Nipal1 A G 5: 72,667,635 I224V possibly damaging Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Mrgprb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01311:Mrgprb2 APN 7 48551998 missense probably benign 0.29
IGL01509:Mrgprb2 APN 7 48552926 missense possibly damaging 0.70
IGL01978:Mrgprb2 APN 7 48552564 missense probably damaging 0.98
IGL02307:Mrgprb2 APN 7 48552896 missense probably benign 0.01
IGL02726:Mrgprb2 APN 7 48552870 missense probably damaging 0.97
IGL03393:Mrgprb2 APN 7 48552902 missense probably benign 0.13
R0190:Mrgprb2 UTSW 7 48552777 missense possibly damaging 0.95
R0334:Mrgprb2 UTSW 7 48552329 missense probably damaging 1.00
R0514:Mrgprb2 UTSW 7 48551970 missense probably benign 0.05
R2177:Mrgprb2 UTSW 7 48552380 missense probably benign 0.11
R3417:Mrgprb2 UTSW 7 48552533 missense probably damaging 0.98
R3953:Mrgprb2 UTSW 7 48552368 missense possibly damaging 0.78
R5673:Mrgprb2 UTSW 7 48552373 missense probably benign 0.00
R5733:Mrgprb2 UTSW 7 48552513 missense probably benign 0.01
R5890:Mrgprb2 UTSW 7 48551959 makesense probably null
R5915:Mrgprb2 UTSW 7 48552806 missense probably benign 0.14
R6147:Mrgprb2 UTSW 7 48552365 missense possibly damaging 0.64
R6381:Mrgprb2 UTSW 7 48552390 missense probably benign 0.01
R6414:Mrgprb2 UTSW 7 48552381 missense probably benign 0.01
R6965:Mrgprb2 UTSW 7 48552849 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GAGTATCCAATAGATCCCAAAGGG -3'
(R):5'- TGCTTATCTTTCAGGTCTGAGC -3'

Sequencing Primer
(F):5'- ACCAAGACTGTGAGTGTAATAGTC -3'
(R):5'- GAGCATTCTCAGCACCATTAGCATTG -3'
Posted On2014-12-29