Incidental Mutation 'R2932:Lrrc1'
ID254977
Institutional Source Beutler Lab
Gene Symbol Lrrc1
Ensembl Gene ENSMUSG00000032352
Gene Nameleucine rich repeat containing 1
SynonymsA430093J20Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.244) question?
Stock #R2932 (G1)
Quality Score225
Status Not validated
Chromosome9
Chromosomal Location77430823-77544870 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 77457439 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Leucine at position 153 (H153L)
Ref Sequence ENSEMBL: ENSMUSP00000109048 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113421] [ENSMUST00000183734] [ENSMUST00000183873]
Predicted Effect probably benign
Transcript: ENSMUST00000113421
AA Change: H153L

PolyPhen 2 Score 0.013 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000109048
Gene: ENSMUSG00000032352
AA Change: H153L

DomainStartEndE-ValueType
LRR 13 35 6.57e-1 SMART
LRR 36 59 1.12e2 SMART
LRR 82 104 2.15e2 SMART
LRR 105 127 3.09e1 SMART
LRR 128 150 2.14e0 SMART
LRR 151 173 3.02e0 SMART
LRR 174 196 3.47e0 SMART
LRR 197 219 6.58e0 SMART
LRR_TYP 220 243 4.72e-2 SMART
LRR 266 289 8.97e0 SMART
LRR 313 335 1.49e2 SMART
coiled coil region 440 461 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000183572
Predicted Effect probably benign
Transcript: ENSMUST00000183734
AA Change: H198L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000138912
Gene: ENSMUSG00000032352
AA Change: H198L

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 289 311 8.03e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000183873
AA Change: H198L

PolyPhen 2 Score 0.011 (Sensitivity: 0.96; Specificity: 0.78)
SMART Domains Protein: ENSMUSP00000139226
Gene: ENSMUSG00000032352
AA Change: H198L

DomainStartEndE-ValueType
LRR 36 57 3.18e1 SMART
LRR 58 80 6.57e-1 SMART
LRR 81 104 1.12e2 SMART
LRR 127 149 2.15e2 SMART
LRR 150 172 3.09e1 SMART
LRR 173 195 2.14e0 SMART
LRR 196 218 3.02e0 SMART
LRR 219 241 3.47e0 SMART
LRR 242 264 6.58e0 SMART
LRR_TYP 265 288 4.72e-2 SMART
LRR 311 334 8.97e0 SMART
LRR 358 380 1.49e2 SMART
coiled coil region 485 506 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Alms1 A G 6: 85,620,562 D1259G possibly damaging Het
Arpp21 T C 9: 112,179,105 D106G probably damaging Het
Atp6v1a A G 16: 44,089,043 S542P probably benign Het
Ccar1 T C 10: 62,776,759 N209S probably benign Het
Ccdc15 G A 9: 37,315,658 T327I probably benign Het
Dhx15 G A 5: 52,166,732 P406L probably benign Het
Fat3 G A 9: 16,375,944 S761L probably damaging Het
Lor AGCCGCCGCCGCCGCCGCCGCCGCCGCC AGCCGCCGCCGCCGCCGCCGCCGCC 3: 92,081,878 probably benign Het
Lrrc46 T C 11: 97,041,109 probably benign Het
Mrgprb2 A G 7: 48,552,446 L177S probably benign Het
Mtmr2 A T 9: 13,749,117 probably benign Het
Mtnr1b A T 9: 15,874,324 V46E probably damaging Het
Myo5a A G 9: 75,196,136 E207G possibly damaging Het
Nalcn A G 14: 123,593,018 S137P probably benign Het
Nipal1 A G 5: 72,667,635 I224V possibly damaging Het
Oas1g T G 5: 120,879,143 K283Q probably benign Het
Pex12 T A 11: 83,296,223 M300L probably benign Het
Phldb2 A G 16: 45,748,785 V1237A possibly damaging Het
Rc3h2 C A 2: 37,378,359 V920F probably benign Het
Ulk1 C T 5: 110,789,357 R691Q probably benign Het
Other mutations in Lrrc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02556:Lrrc1 APN 9 77435122 missense probably benign 0.00
IGL02975:Lrrc1 APN 9 77452647 missense probably damaging 1.00
IGL03063:Lrrc1 APN 9 77499269 missense probably damaging 0.99
R0610:Lrrc1 UTSW 9 77472206 missense possibly damaging 0.95
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1462:Lrrc1 UTSW 9 77442265 missense probably benign 0.01
R1615:Lrrc1 UTSW 9 77435118 missense possibly damaging 0.94
R5087:Lrrc1 UTSW 9 77457458 missense probably benign
R5907:Lrrc1 UTSW 9 77434097 missense probably damaging 0.99
R6443:Lrrc1 UTSW 9 77434032 missense probably damaging 1.00
R6502:Lrrc1 UTSW 9 77442191 missense probably damaging 1.00
R7073:Lrrc1 UTSW 9 77468565 missense not run
Predicted Primers PCR Primer
(F):5'- GGGCTGCTTCCAAATGTACTTTC -3'
(R):5'- TCAGGACCAGAGATCTGAGC -3'

Sequencing Primer
(F):5'- GCTGCTTCCAAATGTACTTTCTAAAC -3'
(R):5'- AGAGATCTGAGCTCTGGGGC -3'
Posted On2014-12-29