Incidental Mutation 'R2935:Olfr364-ps1'
ID254988
Institutional Source Beutler Lab
Gene Symbol Olfr364-ps1
Ensembl Gene ENSMUSG00000078198
Gene Nameolfactory receptor 364, pseudogene 1
SynonymsGA_x6K02T2NLDC-33831282-33832243, MOR138-4P, MOR138-7
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R2935 (G1)
Quality Score225
Status Not validated
Chromosome2
Chromosomal Location37139322-37148585 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 37147111 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 300 (K300E)
Ref Sequence ENSEMBL: ENSMUSP00000151166 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000104995] [ENSMUST00000214905] [ENSMUST00000217298]
Predicted Effect possibly damaging
Transcript: ENSMUST00000104995
AA Change: K300E

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000100611
Gene: ENSMUSG00000078198
AA Change: K300E

DomainStartEndE-ValueType
Pfam:7tm_4 28 303 4.8e-58 PFAM
Pfam:7tm_1 38 287 5e-24 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000214905
AA Change: K300E

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000217298
AA Change: K300E

PolyPhen 2 Score 0.746 (Sensitivity: 0.85; Specificity: 0.92)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca17 G C 17: 24,289,507 T1018R probably damaging Het
Adgrl1 T C 8: 83,934,560 I894T probably damaging Het
Cd55 A G 1: 130,452,426 S272P possibly damaging Het
Chek2 T C 5: 110,868,020 V467A probably damaging Het
Cyp11a1 A G 9: 58,016,390 Y126C probably damaging Het
Ddx39 T A 8: 83,720,958 V144D possibly damaging Het
Fbxl19 G A 7: 127,752,260 R304H probably damaging Het
Ide A G 19: 37,325,307 F135L unknown Het
Khdc3 T C 9: 73,103,705 V255A possibly damaging Het
Klk1b22 A G 7: 44,114,722 I25V probably benign Het
Magi2 A AG 5: 20,602,461 probably null Het
Mark2 T C 19: 7,285,889 N204S probably benign Het
Olfr1230 A T 2: 89,297,260 N3K possibly damaging Het
Osbpl8 T A 10: 111,269,436 S251T probably benign Het
Piezo2 A G 18: 63,146,843 I219T probably damaging Het
Rap1gap T C 4: 137,724,731 S521P probably benign Het
Rxrb CGCGGCGGCGGCGGCGGCGGC CGCGGCGGCGGCGGCGGC 17: 34,032,132 probably benign Het
Smchd1 G A 17: 71,411,905 P823L probably damaging Het
Sncaip A G 18: 52,838,032 D8G probably damaging Het
Stau1 G A 2: 166,955,117 T120I probably benign Het
Stxbp5l G T 16: 37,134,189 H920N possibly damaging Het
Thsd7b A G 1: 129,678,087 T522A possibly damaging Het
Other mutations in Olfr364-ps1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00264:Olfr364-ps1 APN 2 37147067 missense probably damaging 1.00
IGL01550:Olfr364-ps1 APN 2 37146974 missense probably damaging 1.00
IGL01791:Olfr364-ps1 APN 2 37146536 missense probably damaging 1.00
IGL01886:Olfr364-ps1 APN 2 37146509 missense probably damaging 1.00
IGL02680:Olfr364-ps1 APN 2 37146415 missense probably damaging 1.00
IGL03003:Olfr364-ps1 APN 2 37146452 missense probably benign 0.00
IGL03289:Olfr364-ps1 APN 2 37146578 missense probably damaging 1.00
R0627:Olfr364-ps1 UTSW 2 37146330 missense probably damaging 0.96
R1163:Olfr364-ps1 UTSW 2 37147027 missense probably damaging 1.00
R1253:Olfr364-ps1 UTSW 2 37146872 missense possibly damaging 0.89
R1340:Olfr364-ps1 UTSW 2 37146757 missense probably benign 0.03
R1542:Olfr364-ps1 UTSW 2 37146966 missense probably damaging 1.00
R1633:Olfr364-ps1 UTSW 2 37146971 missense probably damaging 0.99
R2982:Olfr364-ps1 UTSW 2 37146381 missense probably damaging 0.99
R3855:Olfr364-ps1 UTSW 2 37146823 missense possibly damaging 0.95
R4849:Olfr364-ps1 UTSW 2 37146254 missense probably damaging 0.97
R4903:Olfr364-ps1 UTSW 2 37146371 missense probably benign 0.35
R5160:Olfr364-ps1 UTSW 2 37146803 missense probably benign 0.03
R7092:Olfr364-ps1 UTSW 2 37146611 missense probably damaging 1.00
R7108:Olfr364-ps1 UTSW 2 37146260 missense probably benign 0.00
R7143:Olfr364-ps1 UTSW 2 37146874 missense probably benign 0.00
R7278:Olfr364-ps1 UTSW 2 37147009 missense probably benign 0.29
Z1088:Olfr364-ps1 UTSW 2 37146385 missense probably benign 0.09
Predicted Primers PCR Primer
(F):5'- GAAAGCCTTCTCTACTTGTGGCTC -3'
(R):5'- GAGAATGAACATGTACTTGGTCAAG -3'

Sequencing Primer
(F):5'- GCTCCCACCTCACTGTAGTGG -3'
(R):5'- CTTTCAGATCAGTGATGTTGG -3'
Posted On2014-12-29