Incidental Mutation 'R2937:Slc2a2'
ID255039
Institutional Source Beutler Lab
Gene Symbol Slc2a2
Ensembl Gene ENSMUSG00000027690
Gene Namesolute carrier family 2 (facilitated glucose transporter), member 2
SynonymsGlut2, liver-type glucose transporter, Glut-2
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location28697903-28731359 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 28718771 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Glycine at position 238 (C238G)
Ref Sequence ENSEMBL: ENSMUSP00000029240 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029240] [ENSMUST00000163536]
Predicted Effect probably damaging
Transcript: ENSMUST00000029240
AA Change: C238G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000029240
Gene: ENSMUSG00000027690
AA Change: C238G

DomainStartEndE-ValueType
Pfam:MFS_1 9 442 4.2e-23 PFAM
Pfam:Sugar_tr 13 498 2.4e-165 PFAM
Pfam:Folate_carrier 187 458 5.3e-12 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000163536
SMART Domains Protein: ENSMUSP00000131046
Gene: ENSMUSG00000027690

DomainStartEndE-ValueType
Pfam:Sugar_tr 13 133 3.9e-19 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000167704
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169047
Meta Mutation Damage Score 0.474 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an integral plasma membrane glycoprotein of the liver, islet beta cells, intestine, and kidney epithelium. The encoded protein mediates facilitated bidirectional glucose transport. Because of its low affinity for glucose, it has been suggested as a glucose sensor. Mutations in this gene are associated with susceptibility to diseases, including Fanconi-Bickel syndrome and noninsulin-dependent diabetes mellitus (NIDDM). Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, Jul 2013]
PHENOTYPE: Homozygous null mice are hyperglycemic with hypoinsulinemia and die within 2-3 weeks of life displaying increased plasma levels of glucagon, free fatty acids and beta-hydroxybutyrate, abnormal glucose tolerance, and altered postnatal development of pancreatic islets. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Slc7a9 C A 7: 35,463,742 Y457* probably null Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Slc2a2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00836:Slc2a2 APN 3 28718741 missense possibly damaging 0.86
IGL01582:Slc2a2 APN 3 28708488 missense probably benign 0.01
IGL01762:Slc2a2 APN 3 28717472 missense probably damaging 1.00
IGL01942:Slc2a2 APN 3 28705803 missense probably damaging 1.00
IGL02128:Slc2a2 APN 3 28719401 missense probably damaging 1.00
IGL02218:Slc2a2 APN 3 28698025 missense possibly damaging 0.94
IGL02278:Slc2a2 APN 3 28717455 missense probably damaging 0.99
IGL02507:Slc2a2 APN 3 28727111 missense probably benign 0.00
IGL02649:Slc2a2 APN 3 28718736 missense probably damaging 0.97
IGL03323:Slc2a2 APN 3 28726290 missense probably damaging 1.00
IGL03147:Slc2a2 UTSW 3 28719370 missense possibly damaging 0.56
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0063:Slc2a2 UTSW 3 28717440 missense probably damaging 0.98
R0365:Slc2a2 UTSW 3 28708679 critical splice donor site probably null
R0494:Slc2a2 UTSW 3 28727277 missense probably benign 0.01
R0519:Slc2a2 UTSW 3 28718816 missense possibly damaging 0.54
R1292:Slc2a2 UTSW 3 28717488 missense probably damaging 1.00
R1755:Slc2a2 UTSW 3 28713662 intron probably null
R1965:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1966:Slc2a2 UTSW 3 28719485 missense probably damaging 1.00
R1982:Slc2a2 UTSW 3 28717441 missense probably benign 0.36
R3121:Slc2a2 UTSW 3 28721749 missense probably benign 0.01
R3721:Slc2a2 UTSW 3 28727152 missense probably damaging 1.00
R4799:Slc2a2 UTSW 3 28717532 critical splice donor site probably null
R5206:Slc2a2 UTSW 3 28708607 missense probably damaging 1.00
R6829:Slc2a2 UTSW 3 28727441 nonsense probably null
R6864:Slc2a2 UTSW 3 28721725 missense probably damaging 1.00
R6932:Slc2a2 UTSW 3 28717519 missense probably benign 0.40
R7178:Slc2a2 UTSW 3 28719482 missense possibly damaging 0.90
Predicted Primers PCR Primer
(F):5'- TGCATTTCTGTAGAAGGCAAGC -3'
(R):5'- CTCACCGGTCACTTCTAAGTAAC -3'

Sequencing Primer
(F):5'- CCCAGAGTACTGTGCAGTTCATG -3'
(R):5'- GCCATAGCTAAGGCCTTTGTAGTC -3'
Posted On2014-12-29