Incidental Mutation 'R2937:Slc7a9'
ID255066
Institutional Source Beutler Lab
Gene Symbol Slc7a9
Ensembl Gene ENSMUSG00000030492
Gene Namesolute carrier family 7 (cationic amino acid transporter, y+ system), member 9
Synonymsb, + amino acid transporter, CSNU3, b, +AT
MMRRC Submission 040514-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.170) question?
Stock #R2937 (G1)
Quality Score225
Status Validated
Chromosome7
Chromosomal Location35448796-35466036 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 35463742 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 457 (Y457*)
Ref Sequence ENSEMBL: ENSMUSP00000112726 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032703] [ENSMUST00000118383] [ENSMUST00000118969]
Predicted Effect probably null
Transcript: ENSMUST00000032703
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000032703
Gene: ENSMUSG00000030492
AA Change: Y457*

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118383
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000113181
Gene: ENSMUSG00000030492
AA Change: Y457*

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 456 9e-67 PFAM
Pfam:AA_permease 35 468 4.8e-25 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000118969
AA Change: Y457*
SMART Domains Protein: ENSMUSP00000112726
Gene: ENSMUSG00000030492
AA Change: Y457*

DomainStartEndE-ValueType
Pfam:AA_permease_2 30 457 1.8e-65 PFAM
Pfam:AA_permease 35 468 2.2e-24 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147026
Meta Mutation Damage Score 0.662 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.4%
  • 20x: 95.6%
Validation Efficiency 100% (73/73)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein that belongs to a family of light subunits of amino acid transporters. This protein plays a role in the high-affinity and sodium-independent transport of cystine and neutral and dibasic amino acids, and appears to function in the reabsorption of cystine in the kidney tubule. Mutations in this gene cause non-type I cystinuria, a disease that leads to cystine stones in the urinary system due to impaired transport of cystine and dibasic amino acids. Alternate transcript variants, which encode the same protein, have been found for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Inactivation of this locus leads to renal absorption defects and cystine urolithiasis, similar to the symptoms observed in patients with cystinuria. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 73 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Acsm1 A G 7: 119,659,127 E481G probably damaging Het
Anks1b C T 10: 90,077,066 T351M probably damaging Het
Arhgap45 T A 10: 80,029,002 M933K probably damaging Het
Asph A C 4: 9,542,314 probably benign Het
Bace2 T C 16: 97,412,188 probably null Het
BC051142 A T 17: 34,421,862 H57L possibly damaging Het
Cacna1b A G 2: 24,606,528 V125A probably benign Het
Cbarp T C 10: 80,131,769 D539G probably damaging Het
Ccdc59 A T 10: 105,841,527 K9M possibly damaging Het
Cdh15 G A 8: 122,862,024 R279Q probably damaging Het
Cdr1 T G X: 61,185,362 D66A unknown Het
Cela3b A G 4: 137,423,263 I208T probably benign Het
Clca3a2 T A 3: 144,813,918 T232S probably benign Het
Col1a2 G A 6: 4,519,882 probably benign Het
Col1a2 A T 6: 4,520,788 Q375L possibly damaging Het
Cpd T C 11: 76,811,859 N561S probably damaging Het
Csn1s1 A T 5: 87,677,136 Q221L possibly damaging Het
Depdc5 G A 5: 32,901,621 probably null Het
Dnah10 T C 5: 124,819,412 probably null Het
Dsg2 T C 18: 20,579,128 F107S probably damaging Het
Dthd1 A G 5: 62,842,957 I541V probably benign Het
Eml6 G A 11: 29,833,049 probably benign Het
Fermt2 A C 14: 45,504,491 probably null Het
Gimap8 A T 6: 48,658,796 R498S possibly damaging Het
Glis1 A G 4: 107,632,291 N692D possibly damaging Het
Grtp1 G A 8: 13,189,755 probably benign Het
Hecw1 G T 13: 14,245,836 Q1001K possibly damaging Het
Hydin T C 8: 110,404,295 V606A possibly damaging Het
Krt33b T A 11: 100,024,009 N388I probably benign Het
Lipf T C 19: 33,973,038 Y277H probably damaging Het
Lmod1 A G 1: 135,363,916 K170E probably benign Het
Lrrtm1 A T 6: 77,243,652 M31L probably benign Het
Maats1 A T 16: 38,311,038 I471N possibly damaging Het
Man1c1 A G 4: 134,702,952 I173T possibly damaging Het
Med17 T C 9: 15,275,891 K196E probably damaging Het
Mmp25 T A 17: 23,644,791 I22F probably benign Het
Nrg3 T A 14: 38,371,008 N540I possibly damaging Het
Nsun5 C T 5: 135,375,463 Q375* probably null Het
Olfr584 T A 7: 103,086,341 H269Q probably benign Het
Olfr600 T C 7: 103,346,065 M288V probably benign Het
Pcdh1 G T 18: 38,189,762 A1006E probably benign Het
Pdss1 T A 2: 22,906,787 probably null Het
Plaa G A 4: 94,569,459 A758V probably damaging Het
Prl6a1 T A 13: 27,315,320 W24R probably damaging Het
Ptk7 T C 17: 46,572,550 H863R probably damaging Het
Rbm10 T C X: 20,647,695 L429P possibly damaging Het
Rhou T C 8: 123,661,141 I204T possibly damaging Het
Serpind1 G T 16: 17,337,108 M266I probably benign Het
Sgcg A T 14: 61,229,625 F175L probably damaging Het
Slc2a2 T G 3: 28,718,771 C238G probably damaging Het
Slc39a8 A G 3: 135,886,823 M420V probably benign Het
Smpd3 C T 8: 106,264,820 R367H probably damaging Het
Sntb2 T C 8: 106,936,097 V99A probably benign Het
Specc1l T G 10: 75,259,131 I796R probably damaging Het
Stfa2l1 G T 16: 36,159,946 V29F probably damaging Het
Synrg T C 11: 83,994,354 F455S probably damaging Het
Tap2 T C 17: 34,212,354 V422A possibly damaging Het
Tcf7 A T 11: 52,282,783 probably null Het
Tcp10a A G 17: 7,329,774 Y110C probably damaging Het
Thoc1 T A 18: 9,959,255 S43R probably damaging Het
Tlr1 A G 5: 64,925,908 V442A probably damaging Het
Tmub1 A G 5: 24,445,924 *261Q probably null Het
Trpc3 G A 3: 36,634,383 R836* probably null Het
Ube2u T C 4: 100,524,298 S185P possibly damaging Het
Vamp5 A G 6: 72,369,340 V91A probably benign Het
Vcp A G 4: 42,980,846 Y755H probably damaging Het
Vmn1r35 A T 6: 66,678,966 M73K possibly damaging Het
Vmn2r12 C T 5: 109,091,531 E389K probably damaging Het
Wdfy3 A T 5: 101,944,122 F450L probably benign Het
Xpo4 G T 14: 57,604,440 Q473K probably benign Het
Xpo7 A G 14: 70,671,690 I797T probably damaging Het
Xylt1 C A 7: 117,634,784 Q513K probably benign Het
Zfp229 T C 17: 21,745,503 F238S probably damaging Het
Other mutations in Slc7a9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00486:Slc7a9 APN 7 35460887 missense probably damaging 0.97
IGL01538:Slc7a9 APN 7 35454164 missense probably damaging 0.97
IGL01860:Slc7a9 APN 7 35457060 missense probably damaging 1.00
IGL02291:Slc7a9 APN 7 35457014 missense probably damaging 1.00
IGL02436:Slc7a9 APN 7 35457053 missense probably benign 0.23
IGL02525:Slc7a9 APN 7 35453435 missense probably damaging 1.00
IGL03296:Slc7a9 APN 7 35452427 missense probably damaging 1.00
R0006:Slc7a9 UTSW 7 35470100 unclassified probably benign
R1703:Slc7a9 UTSW 7 35454575 missense probably benign
R1886:Slc7a9 UTSW 7 35453402 missense possibly damaging 0.94
R1886:Slc7a9 UTSW 7 35453403 missense probably damaging 0.96
R1907:Slc7a9 UTSW 7 35449854 missense probably benign 0.00
R2027:Slc7a9 UTSW 7 35454137 missense probably damaging 0.97
R2133:Slc7a9 UTSW 7 35453493 missense probably damaging 0.99
R3684:Slc7a9 UTSW 7 35453501 missense probably benign 0.02
R4506:Slc7a9 UTSW 7 35453420 missense probably damaging 1.00
R4731:Slc7a9 UTSW 7 35453563 nonsense probably null
R4732:Slc7a9 UTSW 7 35453563 nonsense probably null
R4733:Slc7a9 UTSW 7 35453563 nonsense probably null
R5007:Slc7a9 UTSW 7 35454129 missense probably benign 0.09
R6175:Slc7a9 UTSW 7 35465852 missense probably damaging 1.00
R6405:Slc7a9 UTSW 7 35454639 missense probably damaging 1.00
R6701:Slc7a9 UTSW 7 35459849 missense probably damaging 1.00
R6932:Slc7a9 UTSW 7 35452511 missense probably benign 0.16
X0022:Slc7a9 UTSW 7 35452502 missense possibly damaging 0.91
Predicted Primers PCR Primer
(F):5'- TCCCACGTGTTGATGTTCTG -3'
(R):5'- CCTCAGTGTGGTCTTCAAGG -3'

Sequencing Primer
(F):5'- GTTCTGCTTGCAGGTGCCC -3'
(R):5'- CCTCAGTGTGGTCTTCAAGGAAAAC -3'
Posted On2014-12-29