Incidental Mutation 'R2973:Ces5a'
ID255285
Institutional Source Beutler Lab
Gene Symbol Ces5a
Ensembl Gene ENSMUSG00000058019
Gene Namecarboxylesterase 5A
SynonymsCes7, 1700122C07Rik, LOC244598, 1700081L16Rik, cauxin
MMRRC Submission 040526-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.094) question?
Stock #R2973 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location93499064-93535830 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 93528504 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Serine at position 187 (F187S)
Ref Sequence ENSEMBL: ENSMUSP00000148373 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077816] [ENSMUST00000212009] [ENSMUST00000212722]
Predicted Effect probably damaging
Transcript: ENSMUST00000077816
AA Change: F183S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076988
Gene: ENSMUSG00000058019
AA Change: F183S

DomainStartEndE-ValueType
Pfam:COesterase 10 539 3.2e-157 PFAM
Pfam:Abhydrolase_3 141 238 9.5e-7 PFAM
low complexity region 552 575 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000212009
AA Change: F183S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Predicted Effect probably damaging
Transcript: ENSMUST00000212722
AA Change: F187S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.274 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency 98% (44/45)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the carboxylesterase large family. The family members are responsible for the hydrolysis or transesterification of various xenobiotics, such as cocaine and heroin, and endogenous substrates with ester, thioester, or amide bonds. They also participate in fatty acyl and cholesterol ester metabolism, and may play a role in the blood-brain barrier system. This gene, also called CES5, is predominantly expressed in peripheral tissues, including brain, kidney, lung and testis. It encodes a secreted enzyme. Because of high levels in the urine of male domestic cats, this enzyme is also called cauxin (carboxylesterase-like urinary excreted protein). The enzyme functions in regulating the production of a pheromone precursor and may contribute to lipid and cholesterol transfer processes within male reproductive fluids. Multiple transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Jun 2010]
Allele List at MGI
Other mutations in this stock
Total: 45 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9230104L09Rik T C 2: 148,850,786 D32G probably benign Het
Abca7 T G 10: 80,008,967 F1508V probably damaging Het
Angptl7 T A 4: 148,500,214 K26* probably null Het
BC048507 T C 13: 67,863,630 I42T probably benign Het
Cald1 A G 6: 34,757,996 probably benign Het
Chd3 A G 11: 69,360,616 Y530H probably damaging Het
Crnkl1 A G 2: 145,932,261 L94P probably benign Het
Cst9 G T 2: 148,835,225 probably null Het
D930007J09Rik C T 13: 32,802,759 probably benign Het
Dcaf10 T C 4: 45,373,957 S461P probably benign Het
Dhx36 T A 3: 62,495,495 N279Y probably benign Het
Dhx36 C G 3: 62,495,498 G278R possibly damaging Het
Doxl2 A G 6: 48,976,424 T428A probably benign Het
Eps8l3 T C 3: 107,891,328 I510T probably damaging Het
Gab2 A G 7: 97,223,552 E54G probably benign Het
Gsdme A G 6: 50,229,324 C180R probably damaging Het
Hesx1 A G 14: 27,000,642 probably benign Het
Il5ra G A 6: 106,741,235 P86L probably benign Het
Jakmip1 A G 5: 37,091,527 K177R probably damaging Het
Larp4b T C 13: 9,166,311 probably benign Het
Lrrc42 A T 4: 107,239,114 D40E probably damaging Het
Mefv G A 16: 3,715,694 R238* probably null Het
Mroh9 A T 1: 163,056,769 M400K probably damaging Het
Olfr1164 A G 2: 88,093,114 L274P probably benign Het
Olfr204 A C 16: 59,315,404 M1R probably null Het
Olfr527 T G 7: 140,336,387 F175C probably damaging Het
Plec C G 15: 76,188,761 G631R probably damaging Het
Polr3b A G 10: 84,628,280 K35E probably benign Het
Ppef2 T C 5: 92,239,094 E328G probably benign Het
Rogdi G T 16: 5,011,662 Q90K probably damaging Het
Rtn1 C A 12: 72,223,389 R116L probably damaging Het
Sept14 T C 5: 129,699,022 H31R probably benign Het
Serpinb9e T A 13: 33,255,143 V184E probably benign Het
Slc10a5 A T 3: 10,334,457 I381N probably damaging Het
Slit1 G A 19: 41,611,016 P1032L probably benign Het
Sptlc3 A G 2: 139,589,661 T368A probably damaging Het
Tm9sf1 T A 14: 55,641,114 T274S probably benign Het
Tpgs1 A G 10: 79,669,615 E69G probably damaging Het
Trpv5 T C 6: 41,653,231 S642G possibly damaging Het
Ttn A C 2: 76,802,317 I12385S probably damaging Het
Ube2e2 T C 14: 18,630,321 D137G possibly damaging Het
Ubr4 T C 4: 139,406,536 Y748H probably benign Het
Ugt8a T C 3: 125,915,308 H51R probably benign Het
Vcp T A 4: 42,996,315 I16F probably damaging Het
Vmn2r117 A G 17: 23,459,856 V798A probably damaging Het
Other mutations in Ces5a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01069:Ces5a APN 8 93525544 critical splice donor site probably null
IGL01520:Ces5a APN 8 93519578 missense probably benign 0.08
IGL01674:Ces5a APN 8 93502219 missense probably damaging 1.00
IGL02257:Ces5a APN 8 93525598 missense probably benign 0.00
IGL02456:Ces5a APN 8 93528644 splice site probably benign
IGL03027:Ces5a APN 8 93523114 unclassified probably null
IGL03051:Ces5a APN 8 93528598 missense probably damaging 1.00
IGL03264:Ces5a APN 8 93502270 missense possibly damaging 0.74
IGL03290:Ces5a APN 8 93519632 missense probably damaging 1.00
R0115:Ces5a UTSW 8 93502183 missense probably damaging 0.98
R0124:Ces5a UTSW 8 93528555 missense probably damaging 1.00
R0521:Ces5a UTSW 8 93525658 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1404:Ces5a UTSW 8 93502181 missense probably damaging 1.00
R1524:Ces5a UTSW 8 93525665 missense probably damaging 0.96
R1843:Ces5a UTSW 8 93514231 missense probably damaging 1.00
R2029:Ces5a UTSW 8 93534577 missense probably damaging 1.00
R2135:Ces5a UTSW 8 93499741 missense probably benign 0.33
R2146:Ces5a UTSW 8 93534699 missense probably benign 0.03
R3755:Ces5a UTSW 8 93528502 missense probably benign 0.15
R4755:Ces5a UTSW 8 93535677 missense probably benign 0.39
R5072:Ces5a UTSW 8 93534668 missense probably damaging 1.00
R5278:Ces5a UTSW 8 93525638 missense probably damaging 1.00
R5419:Ces5a UTSW 8 93499431 missense unknown
R5825:Ces5a UTSW 8 93525667 missense probably damaging 1.00
R6318:Ces5a UTSW 8 93534583 missense probably damaging 1.00
R6925:Ces5a UTSW 8 93523057 intron probably null
R6950:Ces5a UTSW 8 93530774 missense probably benign 0.10
R7148:Ces5a UTSW 8 93502322 missense probably damaging 1.00
R7256:Ces5a UTSW 8 93499526 missense probably benign 0.13
R7290:Ces5a UTSW 8 93534683 missense probably damaging 1.00
X0024:Ces5a UTSW 8 93514213 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACGAAGATCAAGAGTACCTGC -3'
(R):5'- CACCATGGGAAAGGACTGAC -3'

Sequencing Primer
(F):5'- CTAGGGCCCTGATTAACCATGTG -3'
(R):5'- GACTGACTGAAGTGACTCTGTCC -3'
Posted On2014-12-29