Incidental Mutation 'R2975:Traf3ip2'
ID 255349
Institutional Source Beutler Lab
Gene Symbol Traf3ip2
Ensembl Gene ENSMUSG00000019842
Gene Name TRAF3 interacting protein 2
Synonyms Act1
Accession Numbers
Essential gene? Probably non essential (E-score: 0.120) question?
Stock # R2975 (G1)
Quality Score 225
Status Not validated
Chromosome 10
Chromosomal Location 39488930-39531303 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 39502536 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Proline at position 228 (Q228P)
Ref Sequence ENSEMBL: ENSMUSP00000019987 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019987]
AlphaFold Q8N7N6
Predicted Effect probably benign
Transcript: ENSMUST00000019987
AA Change: Q228P

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000019987
Gene: ENSMUSG00000019842
AA Change: Q228P

DomainStartEndE-ValueType
low complexity region 22 37 N/A INTRINSIC
low complexity region 94 106 N/A INTRINSIC
low complexity region 164 179 N/A INTRINSIC
Pfam:SEFIR 391 533 1.2e-38 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129191
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133302
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139356
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143651
Predicted Effect noncoding transcript
Transcript: ENSMUST00000151921
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153261
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein involved in regulating responses to cytokines by members of the Rel/NF-kappaB transcription factor family. These factors play a central role in innate immunity in response to pathogens, inflammatory signals and stress. This gene product interacts with TRAF proteins (tumor necrosis factor receptor-associated factors) and either I-kappaB kinase or MAP kinase to activate either NF-kappaB or Jun kinase. Several alternative transcripts encoding different isoforms have been identified. Another transcript, which does not encode a protein and is transcribed in the opposite orientation, has been identified. Overexpression of this transcript has been shown to reduce expression of at least one of the protein encoding transcripts, suggesting it has a regulatory role in the expression of this gene. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for one null allele exhibit splenomegaly, lymphadenopathy, increased number of B cells, defective IL-17 signaling, and increased immunoglobulin levels (including auto-antibodies) whereas mice homozygous for another null allele lack these features except the defect in IL-17 signaling. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,847,099 (GRCm39) N251D probably damaging Het
Cdca3 A T 6: 124,807,616 (GRCm39) probably null Het
Fabp3 C T 4: 130,206,180 (GRCm39) T57I probably benign Het
Fut8 T C 12: 77,411,787 (GRCm39) V83A probably benign Het
Gnb1l T C 16: 18,383,016 (GRCm39) S352P probably damaging Het
Hmgxb3 A T 18: 61,296,038 (GRCm39) Y323* probably null Het
Katna1 A T 10: 7,619,473 (GRCm39) K160N probably benign Het
Kif7 C A 7: 79,360,008 (GRCm39) A410S probably damaging Het
Mrpl43 T C 19: 44,994,498 (GRCm39) probably null Het
Muc6 T A 7: 141,216,951 (GRCm39) E2574V possibly damaging Het
Naip6 A G 13: 100,424,695 (GRCm39) V1199A probably damaging Het
Ntn4 A G 10: 93,480,753 (GRCm39) Y122C probably damaging Het
Pon3 A G 6: 5,232,345 (GRCm39) I225T probably damaging Het
Rrp1b T A 17: 32,277,547 (GRCm39) V609E probably damaging Het
Scube1 T C 15: 83,543,299 (GRCm39) T180A probably damaging Het
Tas2r136 C A 6: 132,754,972 (GRCm39) V52L probably damaging Het
Tas2r138 A G 6: 40,590,198 (GRCm39) I16T probably benign Het
Vmn2r54 A G 7: 12,369,919 (GRCm39) M48T possibly damaging Het
Washc5 T C 15: 59,217,207 (GRCm39) N787D probably damaging Het
Zbed6 T C 1: 133,585,975 (GRCm39) Y454C probably damaging Het
Other mutations in Traf3ip2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01941:Traf3ip2 APN 10 39,510,656 (GRCm39) missense probably benign
IGL02097:Traf3ip2 APN 10 39,530,475 (GRCm39) missense probably damaging 0.99
IGL02530:Traf3ip2 APN 10 39,522,902 (GRCm39) missense possibly damaging 0.80
IGL02957:Traf3ip2 APN 10 39,530,406 (GRCm39) missense probably damaging 1.00
IGL03034:Traf3ip2 APN 10 39,502,215 (GRCm39) missense probably damaging 1.00
IGL03123:Traf3ip2 APN 10 39,515,218 (GRCm39) missense possibly damaging 0.87
IGL03386:Traf3ip2 APN 10 39,521,704 (GRCm39) missense probably benign 0.03
R0328:Traf3ip2 UTSW 10 39,510,669 (GRCm39) missense probably damaging 0.96
R1282:Traf3ip2 UTSW 10 39,502,401 (GRCm39) missense probably damaging 1.00
R1913:Traf3ip2 UTSW 10 39,501,936 (GRCm39) missense probably benign 0.00
R4575:Traf3ip2 UTSW 10 39,510,650 (GRCm39) missense probably damaging 0.97
R4576:Traf3ip2 UTSW 10 39,510,650 (GRCm39) missense probably damaging 0.97
R4578:Traf3ip2 UTSW 10 39,510,650 (GRCm39) missense probably damaging 0.97
R4670:Traf3ip2 UTSW 10 39,515,256 (GRCm39) missense possibly damaging 0.76
R4680:Traf3ip2 UTSW 10 39,515,256 (GRCm39) missense possibly damaging 0.76
R4681:Traf3ip2 UTSW 10 39,515,256 (GRCm39) missense possibly damaging 0.76
R4710:Traf3ip2 UTSW 10 39,515,256 (GRCm39) missense possibly damaging 0.76
R4742:Traf3ip2 UTSW 10 39,515,256 (GRCm39) missense possibly damaging 0.76
R4760:Traf3ip2 UTSW 10 39,521,735 (GRCm39) missense probably damaging 1.00
R4934:Traf3ip2 UTSW 10 39,502,096 (GRCm39) missense probably damaging 1.00
R5079:Traf3ip2 UTSW 10 39,502,473 (GRCm39) missense probably damaging 1.00
R5959:Traf3ip2 UTSW 10 39,517,337 (GRCm39) missense probably benign 0.13
R6421:Traf3ip2 UTSW 10 39,515,400 (GRCm39) splice site probably null
R6462:Traf3ip2 UTSW 10 39,515,243 (GRCm39) missense probably benign 0.00
R7156:Traf3ip2 UTSW 10 39,502,173 (GRCm39) missense possibly damaging 0.61
R7840:Traf3ip2 UTSW 10 39,502,451 (GRCm39) missense probably damaging 0.99
R9489:Traf3ip2 UTSW 10 39,521,772 (GRCm39) missense probably benign 0.08
R9605:Traf3ip2 UTSW 10 39,521,772 (GRCm39) missense probably benign 0.08
X0020:Traf3ip2 UTSW 10 39,530,515 (GRCm39) missense probably damaging 0.97
Z1177:Traf3ip2 UTSW 10 39,502,529 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- TTCAGTGGTGGCCAAGAGATG -3'
(R):5'- TAGTCTCTGGACGTTGGCAG -3'

Sequencing Primer
(F):5'- TGGCCAAGAGATGATGCCC -3'
(R):5'- CAGTGTTGTGAGGTCTCGTTTCC -3'
Posted On 2014-12-29