Incidental Mutation 'R2975:Washc5'
ID255354
Institutional Source Beutler Lab
Gene Symbol Washc5
Ensembl Gene ENSMUSG00000022350
Gene NameWASH complex subunit 5
SynonymsE430025E21Rik, strumpellin
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.932) question?
Stock #R2975 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location59331997-59374167 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 59345358 bp
ZygosityHeterozygous
Amino Acid Change Asparagine to Aspartic acid at position 787 (N787D)
Ref Sequence ENSEMBL: ENSMUSP00000022976 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022976] [ENSMUST00000227725]
Predicted Effect probably damaging
Transcript: ENSMUST00000022976
AA Change: N787D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000022976
Gene: ENSMUSG00000022350
AA Change: N787D

DomainStartEndE-ValueType
Pfam:Strumpellin 23 1103 N/A PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000227725
AA Change: N337D

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 134 kDa protein named strumpellin that is predicted to have multiple transmembrane domains and a spectrin-repeat-containing domain. This ubiquitously expressed gene has its highest expression in skeletal muscle. The protein is named for Strumpell disease; a form of hereditary spastic paraplegia (HSP). Spastic paraplegias are a diverse group of disorders in which the autosomal dominant forms are characterized by progressive, lower extremity spasticity caused by axonal degeneration in the terminal portions of the longest descending and ascending corticospinal tracts. More than 30 loci (SPG1-33) have been implicated in hereditary spastic paraplegia diseases. [provided by RefSeq, Aug 2009]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal coat color and melanocyte stem cells but enlarged, clustered WASH- and WAFL-positive vesicles. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abi1 T C 2: 22,957,087 N251D probably damaging Het
Cdca3 A T 6: 124,830,653 probably null Het
Fabp3 C T 4: 130,312,387 T57I probably benign Het
Fut8 T C 12: 77,365,013 V83A probably benign Het
Gm38394 T C 1: 133,658,237 Y454C probably damaging Het
Gnb1l T C 16: 18,564,266 S352P probably damaging Het
Hmgxb3 A T 18: 61,162,966 Y323* probably null Het
Katna1 A T 10: 7,743,709 K160N probably benign Het
Kif7 C A 7: 79,710,260 A410S probably damaging Het
Mrpl43 T C 19: 45,006,059 probably null Het
Muc6 T A 7: 141,637,038 E2574V possibly damaging Het
Naip6 A G 13: 100,288,187 V1199A probably damaging Het
Ntn4 A G 10: 93,644,891 Y122C probably damaging Het
Pon3 A G 6: 5,232,345 I225T probably damaging Het
Rrp1b T A 17: 32,058,573 V609E probably damaging Het
Scube1 T C 15: 83,659,098 T180A probably damaging Het
Tas2r136 C A 6: 132,778,009 V52L probably damaging Het
Tas2r138 A G 6: 40,613,264 I16T probably benign Het
Traf3ip2 A C 10: 39,626,540 Q228P probably benign Het
Vmn2r54 A G 7: 12,635,992 M48T possibly damaging Het
Other mutations in Washc5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00861:Washc5 APN 15 59337276 missense probably damaging 0.99
IGL01096:Washc5 APN 15 59350211 splice site probably benign
IGL01305:Washc5 APN 15 59355839 nonsense probably null
IGL01707:Washc5 APN 15 59342015 missense possibly damaging 0.89
IGL01921:Washc5 APN 15 59342109 splice site probably null
IGL02056:Washc5 APN 15 59350336 missense possibly damaging 0.63
IGL02145:Washc5 APN 15 59369211 missense probably benign
IGL02430:Washc5 APN 15 59366291 missense probably damaging 1.00
IGL02450:Washc5 APN 15 59332317 nonsense probably null
IGL03238:Washc5 APN 15 59346842 missense probably damaging 1.00
IGL03351:Washc5 APN 15 59363350 splice site probably benign
ANU22:Washc5 UTSW 15 59355839 nonsense probably null
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0004:Washc5 UTSW 15 59367467 missense probably damaging 1.00
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0100:Washc5 UTSW 15 59344098 missense possibly damaging 0.83
R0179:Washc5 UTSW 15 59352530 missense probably benign 0.01
R0265:Washc5 UTSW 15 59338960 missense probably benign 0.43
R0315:Washc5 UTSW 15 59341976 missense probably damaging 1.00
R0545:Washc5 UTSW 15 59342093 missense possibly damaging 0.50
R0611:Washc5 UTSW 15 59341158 missense probably damaging 0.99
R0636:Washc5 UTSW 15 59359409 missense probably benign 0.01
R1006:Washc5 UTSW 15 59369186 missense probably benign 0.21
R1006:Washc5 UTSW 15 59369187 missense probably benign 0.06
R1237:Washc5 UTSW 15 59338908 splice site probably benign
R1835:Washc5 UTSW 15 59359340 missense possibly damaging 0.86
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R1888:Washc5 UTSW 15 59359325 missense probably damaging 0.99
R2005:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2006:Washc5 UTSW 15 59341155 missense possibly damaging 0.89
R2060:Washc5 UTSW 15 59350408 missense probably damaging 1.00
R2134:Washc5 UTSW 15 59369234 missense probably damaging 1.00
R2139:Washc5 UTSW 15 59350142 missense probably damaging 1.00
R2177:Washc5 UTSW 15 59363269 nonsense probably null
R4088:Washc5 UTSW 15 59339862 missense probably damaging 1.00
R4824:Washc5 UTSW 15 59333636 nonsense probably null
R4843:Washc5 UTSW 15 59350371 missense possibly damaging 0.95
R4991:Washc5 UTSW 15 59344080 missense probably damaging 1.00
R4996:Washc5 UTSW 15 59333635 missense probably benign
R5103:Washc5 UTSW 15 59350169 missense probably damaging 1.00
R5312:Washc5 UTSW 15 59345528 splice site probably null
R5591:Washc5 UTSW 15 59369163 missense probably damaging 1.00
R6073:Washc5 UTSW 15 59335170 missense possibly damaging 0.90
R6123:Washc5 UTSW 15 59335110 missense probably damaging 1.00
R6156:Washc5 UTSW 15 59345399 missense probably damaging 1.00
R6292:Washc5 UTSW 15 59355934 missense probably damaging 1.00
R6297:Washc5 UTSW 15 59344046 missense possibly damaging 0.61
R6374:Washc5 UTSW 15 59337195 missense probably benign 0.14
R6659:Washc5 UTSW 15 59340890 critical splice donor site probably null
R6880:Washc5 UTSW 15 59350172 missense probably benign 0.00
R7146:Washc5 UTSW 15 59352501 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GGCAAGTCTCTGAAAGGTGC -3'
(R):5'- ACCGTTTGCTCCTGTTGATAG -3'

Sequencing Primer
(F):5'- CAAGTCTCTGAAAGGTGCTCTGC -3'
(R):5'- ACCGTTTGCTCCTGTTGATAGTTTTC -3'
Posted On2014-12-29