Incidental Mutation 'R2919:Atg9b'
ID255416
Institutional Source Beutler Lab
Gene Symbol Atg9b
Ensembl Gene ENSMUSG00000038295
Gene Nameautophagy related 9B
SynonymsLOC213948, Apg9l2, Nos3as, eONE
MMRRC Submission 040504-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.166) question?
Stock #R2919 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location24384181-24392143 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 24391544 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 125 (T125S)
Ref Sequence ENSEMBL: ENSMUSP00000051864 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059401] [ENSMUST00000073076] [ENSMUST00000115077] [ENSMUST00000138168]
Predicted Effect possibly damaging
Transcript: ENSMUST00000059401
AA Change: T125S

PolyPhen 2 Score 0.660 (Sensitivity: 0.86; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000051864
Gene: ENSMUSG00000038295
AA Change: T125S

DomainStartEndE-ValueType
low complexity region 3 18 N/A INTRINSIC
low complexity region 22 38 N/A INTRINSIC
low complexity region 115 131 N/A INTRINSIC
transmembrane domain 219 241 N/A INTRINSIC
transmembrane domain 279 296 N/A INTRINSIC
Pfam:APG9 321 681 1.2e-100 PFAM
low complexity region 782 799 N/A INTRINSIC
low complexity region 838 847 N/A INTRINSIC
low complexity region 854 871 N/A INTRINSIC
low complexity region 876 889 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000073076
SMART Domains Protein: ENSMUSP00000072826
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 3.6e-48 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000115074
SMART Domains Protein: ENSMUSP00000110726
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 2.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115077
SMART Domains Protein: ENSMUSP00000110729
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Pfam:ABC_membrane 130 407 1.1e-56 PFAM
AAA 481 668 8.58e-16 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000128831
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136414
Predicted Effect probably benign
Transcript: ENSMUST00000138168
SMART Domains Protein: ENSMUSP00000119791
Gene: ENSMUSG00000028973

DomainStartEndE-ValueType
low complexity region 29 44 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138716
Meta Mutation Damage Score 0.254 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.6%
  • 20x: 95.9%
Validation Efficiency 98% (53/54)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene functions in the regulation of autophagy, a lysosomal degradation pathway. This gene also functions as an antisense transcript in the posttranscriptional regulation of the endothelial nitric oxide synthase 3 gene, which has 3' overlap with this gene on the opposite strand. Mutations in this gene and disruption of the autophagy process have been associated with multiple cancers. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2012]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700001J03Rik C T 5: 146,185,191 R27H probably benign Het
2310002L09Rik A T 4: 73,950,608 L31Q probably damaging Het
Agbl1 G A 7: 76,414,658 D53N probably damaging Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Als2cl A T 9: 110,897,499 probably null Het
Casp8ap2 A G 4: 32,645,343 D1472G probably damaging Het
Cd1d2 C G 3: 86,987,680 P158A probably damaging Het
Cdc45 A G 16: 18,808,793 I94T probably benign Het
Chd6 T G 2: 160,967,880 D1487A possibly damaging Het
Edem2 T C 2: 155,709,027 Y340C probably damaging Het
Fbxl12 C T 9: 20,642,213 R26H probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Gm5884 A G 6: 128,645,058 noncoding transcript Het
Inpp4b C A 8: 81,985,329 A425E possibly damaging Het
Kif1a A G 1: 93,046,742 Y964H probably damaging Het
Lrp1b A C 2: 41,770,899 C66G probably damaging Het
Lrp4 A G 2: 91,490,730 I1034V probably benign Het
Mmrn2 T C 14: 34,402,922 V820A possibly damaging Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mroh9 A C 1: 163,056,772 M399R probably damaging Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
N4bp2 G A 5: 65,807,098 G830D probably benign Het
Nagpa G A 16: 5,203,787 probably benign Het
Olfr1000 G A 2: 85,608,410 P167S probably benign Het
Olfr690 C T 7: 105,329,860 V111M probably damaging Het
Oxgr1 T A 14: 120,022,809 probably benign Het
Parp3 T A 9: 106,473,725 R323W possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Pfkp C T 13: 6,593,243 G513D probably damaging Het
Pla2g4d T C 2: 120,281,627 probably benign Het
Rtl1 T C 12: 109,591,148 E1419G unknown Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Sgk2 T G 2: 162,999,195 L175R probably damaging Het
Sgk2 C A 2: 162,999,205 F178L probably damaging Het
Sim1 T C 10: 50,909,815 Y255H probably benign Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc38a3 A T 9: 107,657,687 I163N probably damaging Het
Slc39a4 A G 15: 76,616,670 L31P probably damaging Het
Slc5a11 GGTGC G 7: 123,239,372 probably null Het
Slfnl1 G T 4: 120,533,078 probably benign Het
Stradb G A 1: 58,992,669 V247M probably benign Het
Styk1 T A 6: 131,313,004 probably benign Het
Sult1d1 A G 5: 87,559,755 probably benign Het
Syk C T 13: 52,611,121 P95S probably benign Het
Taar2 T A 10: 23,941,556 N331K probably benign Het
Thsd7b A G 1: 130,189,850 probably benign Het
Tldc1 G A 8: 119,768,317 A234V probably benign Het
Tmbim7 G A 5: 3,673,188 probably null Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Tmem184c A T 8: 77,604,647 C158S probably damaging Het
Tmpo A G 10: 91,152,686 I310T probably benign Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Xirp1 T C 9: 120,018,701 E372G possibly damaging Het
Zbtb5 T C 4: 44,994,790 E198G probably damaging Het
Zfp804a A G 2: 82,235,816 N44D probably damaging Het
Other mutations in Atg9b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01739:Atg9b APN 5 24386515 unclassified probably null
IGL02020:Atg9b APN 5 24391058 missense possibly damaging 0.89
R0045:Atg9b UTSW 5 24387398 missense probably damaging 0.99
R1698:Atg9b UTSW 5 24388188 missense probably damaging 1.00
R1807:Atg9b UTSW 5 24387057 missense probably damaging 1.00
R1885:Atg9b UTSW 5 24388254 missense probably damaging 1.00
R2183:Atg9b UTSW 5 24390493 missense probably benign 0.01
R2224:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2226:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2227:Atg9b UTSW 5 24386395 missense possibly damaging 0.77
R2426:Atg9b UTSW 5 24386994 missense probably damaging 1.00
R3003:Atg9b UTSW 5 24391219 missense probably damaging 1.00
R4772:Atg9b UTSW 5 24385239 makesense probably null
R4786:Atg9b UTSW 5 24386089 missense possibly damaging 0.92
R5901:Atg9b UTSW 5 24392019 unclassified probably benign
R6410:Atg9b UTSW 5 24386110 missense possibly damaging 0.46
R6505:Atg9b UTSW 5 24390577 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTCCTTCGGGTACATGAAGC -3'
(R):5'- AGGAGGATCTCTGTCTTCTCTCTG -3'

Sequencing Primer
(F):5'- AAGCAAGGGTTGGTGGTCCTC -3'
(R):5'- ACAAGAAGCTGCTCCTCTTCAGTG -3'
Posted On2014-12-29