Incidental Mutation 'R2920:Ints3'
ID255454
Institutional Source Beutler Lab
Gene Symbol Ints3
Ensembl Gene ENSMUSG00000027933
Gene Nameintegrator complex subunit 3
Synonyms
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.975) question?
Stock #R2920 (G1)
Quality Score215
Status Validated
Chromosome3
Chromosomal Location90391388-90433622 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 90393162 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 884 (E884G)
Ref Sequence ENSEMBL: ENSMUSP00000143196 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029541] [ENSMUST00000029542] [ENSMUST00000071488] [ENSMUST00000196530]
Predicted Effect probably benign
Transcript: ENSMUST00000029541
SMART Domains Protein: ENSMUSP00000029541
Gene: ENSMUSG00000027932

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
low complexity region 38 56 N/A INTRINSIC
Pfam:AMP-binding 138 535 9.2e-62 PFAM
Pfam:AMP-binding_C 543 619 9.6e-9 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000029542
AA Change: E884G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000029542
Gene: ENSMUSG00000027933
AA Change: E884G

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000071488
AA Change: E884G

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000071422
Gene: ENSMUSG00000027933
AA Change: E884G

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 269 493 6e-110 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1019 N/A INTRINSIC
low complexity region 1021 1031 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127064
Predicted Effect probably benign
Transcript: ENSMUST00000132041
SMART Domains Protein: ENSMUSP00000122599
Gene: ENSMUSG00000027932

DomainStartEndE-ValueType
low complexity region 40 64 N/A INTRINSIC
low complexity region 68 89 N/A INTRINSIC
low complexity region 91 106 N/A INTRINSIC
Pfam:AMP-binding 147 501 5.3e-50 PFAM
Pfam:AMP-binding_C 509 585 2.9e-8 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144572
Predicted Effect noncoding transcript
Transcript: ENSMUST00000153978
Predicted Effect probably benign
Transcript: ENSMUST00000196530
AA Change: E884G

PolyPhen 2 Score 0.225 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000143196
Gene: ENSMUSG00000027933
AA Change: E884G

DomainStartEndE-ValueType
low complexity region 11 33 N/A INTRINSIC
Pfam:DUF2356 268 497 5.7e-114 PFAM
low complexity region 557 568 N/A INTRINSIC
low complexity region 632 647 N/A INTRINSIC
low complexity region 666 678 N/A INTRINSIC
coiled coil region 913 940 N/A INTRINSIC
low complexity region 1006 1018 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000198776
Predicted Effect noncoding transcript
Transcript: ENSMUST00000199992
Meta Mutation Damage Score 0.206 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene can form a complex with human single-strand DNA binding proteins 1 or 2 (hSSB1 and hSSB2) and other proteins to mediate genome stability and the DNA damage response. The encoded protein is also part of a multiprotein complex that interacts with the C-terminal domain of RNA polymerase II large subunit to help regulate processing of U1 and U2 small nuclear RNAs. [provided by RefSeq, May 2016]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Ints3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Ints3 APN 3 90406329 missense probably damaging 1.00
IGL01339:Ints3 APN 3 90415156 critical splice donor site probably null
IGL01398:Ints3 APN 3 90392823 missense probably damaging 1.00
IGL01599:Ints3 APN 3 90394322 critical splice donor site probably null
IGL01864:Ints3 APN 3 90415179 missense probably benign 0.33
IGL01984:Ints3 APN 3 90392226 missense possibly damaging 0.79
IGL02325:Ints3 APN 3 90404042 missense probably damaging 1.00
IGL02516:Ints3 APN 3 90403108 missense probably damaging 1.00
IGL02867:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02889:Ints3 APN 3 90392836 missense probably damaging 1.00
IGL02975:Ints3 APN 3 90401837 splice site probably benign
PIT4431001:Ints3 UTSW 3 90396460 missense probably damaging 0.99
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0003:Ints3 UTSW 3 90408511 missense probably benign 0.00
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R0069:Ints3 UTSW 3 90400647 splice site probably benign
R1450:Ints3 UTSW 3 90432828 missense probably damaging 1.00
R1985:Ints3 UTSW 3 90400303 critical splice donor site probably null
R2324:Ints3 UTSW 3 90394094 missense probably damaging 1.00
R2425:Ints3 UTSW 3 90394110 missense possibly damaging 0.91
R3937:Ints3 UTSW 3 90403987 nonsense probably null
R4678:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4679:Ints3 UTSW 3 90408510 missense possibly damaging 0.47
R4719:Ints3 UTSW 3 90415521 missense probably benign 0.20
R4726:Ints3 UTSW 3 90393777 missense probably damaging 1.00
R4993:Ints3 UTSW 3 90415507 missense probably benign 0.05
R5154:Ints3 UTSW 3 90415561 missense probably benign 0.01
R5243:Ints3 UTSW 3 90401144 frame shift probably null
R5454:Ints3 UTSW 3 90408527 missense possibly damaging 0.72
R5678:Ints3 UTSW 3 90403548 missense probably damaging 0.99
R6123:Ints3 UTSW 3 90413554 missense probably benign 0.01
R6548:Ints3 UTSW 3 90392124 unclassified probably benign
R6916:Ints3 UTSW 3 90406334 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TCAGAGGCAGTCCTAAGTGG -3'
(R):5'- TTTGGGAAATCAGTAAGCGACAC -3'

Sequencing Primer
(F):5'- AGTCCTAAGTGGCACAGTGCTG -3'
(R):5'- GTAAGCGACACTGTAGCCATTC -3'
Posted On2014-12-29