Incidental Mutation 'R2920:Tbc1d9'
ID255476
Institutional Source Beutler Lab
Gene Symbol Tbc1d9
Ensembl Gene ENSMUSG00000031709
Gene NameTBC1 domain family, member 9
Synonyms4933431N12Rik, C76116
MMRRC Submission 040505-MU
Accession Numbers

Genbank: NM_001111304.1, NM_027758.4

Is this an essential gene? Probably non essential (E-score: 0.220) question?
Stock #R2920 (G1)
Quality Score225
Status Validated
Chromosome8
Chromosomal Location83165352-83272934 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83210469 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 60 (V60A)
Ref Sequence ENSEMBL: ENSMUSP00000091093 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034145] [ENSMUST00000093393]
Predicted Effect probably benign
Transcript: ENSMUST00000034145
AA Change: V60A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000034145
Gene: ENSMUSG00000031709
AA Change: V60A

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
low complexity region 192 208 N/A INTRINSIC
TBC 279 492 8.68e-56 SMART
Blast:TBC 500 587 5e-35 BLAST
PDB:1BJF|B 579 703 3e-7 PDB
low complexity region 917 937 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000093393
AA Change: V60A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000091093
Gene: ENSMUSG00000031709
AA Change: V60A

DomainStartEndE-ValueType
low complexity region 31 55 N/A INTRINSIC
GRAM 146 213 1.2e-25 SMART
low complexity region 267 278 N/A INTRINSIC
GRAM 293 361 1.37e-20 SMART
low complexity region 425 441 N/A INTRINSIC
TBC 512 725 8.68e-56 SMART
Blast:TBC 733 820 6e-35 BLAST
PDB:1BJF|B 812 936 4e-7 PDB
low complexity region 1150 1170 N/A INTRINSIC
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
Allele List at MGI

All alleles(5) : Targeted, other(2) Gene trapped(3)

Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Atrx A T X: 105,830,868 V1962D probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F467L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Tbc1d9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01067:Tbc1d9 APN 8 83234162 missense probably damaging 1.00
IGL01443:Tbc1d9 APN 8 83239931 missense probably damaging 1.00
IGL01536:Tbc1d9 APN 8 83260992 missense probably damaging 1.00
IGL01811:Tbc1d9 APN 8 83233678 missense probably damaging 1.00
IGL02068:Tbc1d9 APN 8 83239868 missense probably damaging 1.00
IGL02938:Tbc1d9 APN 8 83269067 splice site probably benign
IGL02995:Tbc1d9 APN 8 83269059 critical splice donor site probably null
IGL03127:Tbc1d9 APN 8 83249473 missense probably damaging 1.00
IGL03128:Tbc1d9 APN 8 83166085 missense probably benign 0.01
H9600:Tbc1d9 UTSW 8 83210461 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0067:Tbc1d9 UTSW 8 83234243 missense probably damaging 1.00
R0112:Tbc1d9 UTSW 8 83264837 splice site probably benign
R0525:Tbc1d9 UTSW 8 83268985 missense probably benign 0.08
R0528:Tbc1d9 UTSW 8 83210456 missense probably damaging 1.00
R0737:Tbc1d9 UTSW 8 83259313 missense probably damaging 1.00
R1144:Tbc1d9 UTSW 8 83236571 missense possibly damaging 0.93
R1354:Tbc1d9 UTSW 8 83268981 critical splice acceptor site probably null
R1551:Tbc1d9 UTSW 8 83266158 missense probably benign 0.03
R1620:Tbc1d9 UTSW 8 83249595 missense probably damaging 1.00
R1971:Tbc1d9 UTSW 8 83249510 missense probably damaging 1.00
R1990:Tbc1d9 UTSW 8 83271303 missense probably damaging 1.00
R2082:Tbc1d9 UTSW 8 83270987 missense probably damaging 1.00
R2149:Tbc1d9 UTSW 8 83271449 missense probably damaging 1.00
R2442:Tbc1d9 UTSW 8 83166076 start codon destroyed probably null 0.08
R3832:Tbc1d9 UTSW 8 83233663 missense probably damaging 1.00
R3953:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3955:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3956:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R3957:Tbc1d9 UTSW 8 83233532 missense probably damaging 1.00
R4117:Tbc1d9 UTSW 8 83266147 missense possibly damaging 0.93
R4467:Tbc1d9 UTSW 8 83210478 missense probably damaging 1.00
R4533:Tbc1d9 UTSW 8 83270918 missense probably damaging 1.00
R4568:Tbc1d9 UTSW 8 83271177 missense probably benign 0.00
R4694:Tbc1d9 UTSW 8 83234246 missense probably damaging 1.00
R4804:Tbc1d9 UTSW 8 83255925 critical splice donor site probably null
R5056:Tbc1d9 UTSW 8 83269206 missense probably benign
R5073:Tbc1d9 UTSW 8 83233547 missense probably damaging 1.00
R5122:Tbc1d9 UTSW 8 83236543 missense probably damaging 0.98
R5270:Tbc1d9 UTSW 8 83233654 missense probably benign
R5618:Tbc1d9 UTSW 8 83242592 missense probably damaging 1.00
R5738:Tbc1d9 UTSW 8 83271026 missense probably benign
R5793:Tbc1d9 UTSW 8 83271440 missense probably damaging 0.96
R5908:Tbc1d9 UTSW 8 83249545 missense probably benign 0.05
R6258:Tbc1d9 UTSW 8 83210516 missense probably damaging 1.00
R6584:Tbc1d9 UTSW 8 83261000 missense probably damaging 0.98
R6888:Tbc1d9 UTSW 8 83271588 missense possibly damaging 0.92
R6897:Tbc1d9 UTSW 8 83166180 missense probably damaging 1.00
R6969:Tbc1d9 UTSW 8 83241542 missense probably damaging 0.99
R7026:Tbc1d9 UTSW 8 83241563 missense probably benign 0.06
R7072:Tbc1d9 UTSW 8 83264865 missense probably damaging 0.97
R7099:Tbc1d9 UTSW 8 83254891 missense probably damaging 1.00
R7138:Tbc1d9 UTSW 8 83210484 missense probably damaging 1.00
R7172:Tbc1d9 UTSW 8 83254761 missense probably damaging 0.96
R7267:Tbc1d9 UTSW 8 83271328 missense probably damaging 1.00
X0062:Tbc1d9 UTSW 8 83233702 missense possibly damaging 0.79
Predicted Primers PCR Primer
(F):5'- AATGTAGAGCCCGAGTCCTG -3'
(R):5'- CGTAACCTGACAAAAGACTGAG -3'

Sequencing Primer
(F):5'- AGCCCGAGTCCTGTAAGATG -3'
(R):5'- GACTTACCACAGGCAATG -3'
Posted On2014-12-29