Incidental Mutation 'R2920:Atrx'
ID255499
Institutional Source Beutler Lab
Gene Symbol Atrx
Ensembl Gene ENSMUSG00000031229
Gene NameATRX, chromatin remodeler
SynonymsDXHXS6677E, Rad54, 4833408C14Rik, Hp1bp2, Xnp, HP1-BP38, XH2
MMRRC Submission 040505-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.944) question?
Stock #R2920 (G1)
Quality Score222
Status Validated
ChromosomeX
Chromosomal Location105797615-105929403 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105830868 bp
ZygosityHeterozygous
Amino Acid Change Valine to Aspartic acid at position 1962 (V1962D)
Ref Sequence ENSEMBL: ENSMUSP00000109203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113573] [ENSMUST00000198567]
Predicted Effect probably benign
Transcript: ENSMUST00000113573
AA Change: V1962D

PolyPhen 2 Score 0.221 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000109203
Gene: ENSMUSG00000031229
AA Change: V1962D

DomainStartEndE-ValueType
low complexity region 25 35 N/A INTRINSIC
low complexity region 66 84 N/A INTRINSIC
RING 219 267 4.61e-1 SMART
low complexity region 312 322 N/A INTRINSIC
low complexity region 774 789 N/A INTRINSIC
low complexity region 822 837 N/A INTRINSIC
low complexity region 929 946 N/A INTRINSIC
low complexity region 1021 1039 N/A INTRINSIC
low complexity region 1130 1143 N/A INTRINSIC
low complexity region 1145 1165 N/A INTRINSIC
low complexity region 1179 1194 N/A INTRINSIC
low complexity region 1238 1245 N/A INTRINSIC
low complexity region 1264 1279 N/A INTRINSIC
low complexity region 1309 1318 N/A INTRINSIC
low complexity region 1341 1354 N/A INTRINSIC
low complexity region 1373 1386 N/A INTRINSIC
low complexity region 1407 1416 N/A INTRINSIC
low complexity region 1430 1454 N/A INTRINSIC
coiled coil region 1472 1511 N/A INTRINSIC
DEXDc 1541 1761 2.44e-25 SMART
low complexity region 1898 1932 N/A INTRINSIC
low complexity region 1947 1959 N/A INTRINSIC
low complexity region 1969 1982 N/A INTRINSIC
HELICc 2031 2138 6.1e-17 SMART
low complexity region 2245 2266 N/A INTRINSIC
low complexity region 2397 2413 N/A INTRINSIC
low complexity region 2452 2461 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000127221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141609
Predicted Effect probably benign
Transcript: ENSMUST00000198567
SMART Domains Protein: ENSMUSP00000143007
Gene: ENSMUSG00000031229

DomainStartEndE-ValueType
Pfam:SNF2_N 1 77 3.6e-7 PFAM
Meta Mutation Damage Score 0.1336 question?
Coding Region Coverage
  • 1x: 99.1%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.0%
Validation Efficiency 96% (48/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene contains an ATPase/helicase domain, and thus it belongs to the SWI/SNF family of chromatin remodeling proteins. This protein is found to undergo cell cycle-dependent phosphorylation, which regulates its nuclear matrix and chromatin association, and suggests its involvement in the gene regulation at interphase and chromosomal segregation in mitosis. Mutations in this gene are associated with an X-linked mental retardation (XLMR) syndrome most often accompanied by alpha-thalassemia (ATRX) syndrome. These mutations have been shown to cause diverse changes in the pattern of DNA methylation, which may provide a link between chromatin remodeling, DNA methylation, and gene expression in developmental processes. Multiple alternatively spliced transcript variants encoding distinct isoforms have been reported. [provided by RefSeq, Aug 2013]
PHENOTYPE: Mice homozygous for a floxed allele activated in different tissues at different time points can serve as a model of alpha-thalassemia/mental retardation syndrome, nondeletion type, X-linked. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 47 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgb A G 10: 10,390,243 Y1025H probably damaging Het
Adgrv1 C T 13: 81,448,865 A4122T probably benign Het
Aloxe3 C T 11: 69,142,923 T621I probably damaging Het
Atp2b3 A C X: 73,533,920 T318P probably benign Het
Chl1 C A 6: 103,695,343 T531K probably damaging Het
Clca3b T A 3: 144,837,853 D405V probably benign Het
Clca3b C T 3: 144,846,931 D115N probably benign Het
Comtd1 A G 14: 21,847,618 L149P possibly damaging Het
Cops7a A G 6: 124,962,362 V108A probably benign Het
Crebbp A G 16: 4,119,082 V343A probably damaging Het
Edrf1 T A 7: 133,667,572 D1109E probably benign Het
Elmo3 A G 8: 105,308,059 E359G possibly damaging Het
Ep400 C A 5: 110,755,914 G273V probably damaging Het
Fgfr3 A G 5: 33,733,940 N516S probably damaging Het
Glb1l T A 1: 75,209,190 E31D probably benign Het
Gm10093 A G 17: 78,492,846 D422G probably damaging Het
Il12rb2 C T 6: 67,360,568 V110I probably damaging Het
Ints3 T C 3: 90,393,162 E884G probably benign Het
Lin7b A G 7: 45,368,397 V170A possibly damaging Het
Lrch2 A T X: 147,473,030 V750E probably damaging Het
Mepe C T 5: 104,338,247 R418C probably damaging Het
Mettl25 A T 10: 105,765,177 probably null Het
Mphosph9 G A 5: 124,261,006 T982I probably benign Het
Mslnl G A 17: 25,742,934 V128M probably damaging Het
Myo10 G T 15: 25,801,140 V1472L probably damaging Het
Myo9b A G 8: 71,325,857 K445R probably damaging Het
Ntng2 T C 2: 29,204,211 M383V probably benign Het
Olfr1353 A C 10: 78,970,012 D121A probably damaging Het
Olfr30 T C 11: 58,455,577 Y124C probably damaging Het
Olfr702 C T 7: 106,824,364 R54Q probably benign Het
Pak6 A T 2: 118,694,007 probably benign Het
Pcdh8 G T 14: 79,768,714 P803Q possibly damaging Het
Pfkfb3 C T 2: 11,484,327 V286I probably benign Het
Rbp3 C T 14: 33,956,018 T641M probably damaging Het
Rint1 A G 5: 23,805,402 E203G probably benign Het
Sdf2 G C 11: 78,254,854 V126L probably damaging Het
Slc13a5 T C 11: 72,247,791 E442G possibly damaging Het
Slc14a2 G T 18: 78,158,297 S669* probably null Het
Slc38a7 A G 8: 95,845,943 I157T possibly damaging Het
Slc4a5 T C 6: 83,264,387 L215P probably damaging Het
Tbc1d9 T C 8: 83,210,469 V60A probably benign Het
Tcerg1l T C 7: 138,248,379 R422G probably damaging Het
Tmem107 T C 11: 69,071,421 L68P probably damaging Het
Ugt2b5 A G 5: 87,125,407 F478L possibly damaging Het
Vmn1r19 A T 6: 57,404,924 N154I probably benign Het
Vmn2r69 T A 7: 85,411,765 I204L probably benign Het
Zbtb1 T A 12: 76,385,845 S202T possibly damaging Het
Other mutations in Atrx
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00508:Atrx APN X 105823799 missense probably damaging 0.99
IGL01293:Atrx APN X 105876195 missense probably benign 0.02
IGL01383:Atrx APN X 105802075 missense probably damaging 0.98
IGL01701:Atrx APN X 105830920 missense probably damaging 1.00
IGL02252:Atrx APN X 105845823 missense possibly damaging 0.89
IGL02411:Atrx APN X 105830981 missense possibly damaging 0.82
IGL02929:Atrx APN X 105879906 splice site probably null
IGL03004:Atrx APN X 105832509 nonsense probably null
R1799:Atrx UTSW X 105847629 missense probably damaging 1.00
R3928:Atrx UTSW X 105879917 missense possibly damaging 0.91
R3929:Atrx UTSW X 105879917 missense possibly damaging 0.91
X0028:Atrx UTSW X 105877412 missense probably damaging 0.99
X0060:Atrx UTSW X 105847687 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGACAGAGCAGACTGACTTGC -3'
(R):5'- TATGCTCCCCTAACACAAAGTTCTC -3'

Sequencing Primer
(F):5'- GCAGACTGACTTGCTTACAATTAAAC -3'
(R):5'- AACACAAAGTTCTCTCTCCCTC -3'
Posted On2014-12-29