Incidental Mutation 'R2922:Kcnn3'
ID 255562
Institutional Source Beutler Lab
Gene Symbol Kcnn3
Ensembl Gene ENSMUSG00000000794
Gene Name potassium intermediate/small conductance calcium-activated channel, subfamily N, member 3
Synonyms SK3, small conductance calcium-activated potassium channel 3
MMRRC Submission 040507-MU
Accession Numbers
Essential gene? Possibly essential (E-score: 0.514) question?
Stock # R2922 (G1)
Quality Score 225
Status Validated
Chromosome 3
Chromosomal Location 89427471-89579801 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 89428329 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Alanine at position 185 (V185A)
Ref Sequence ENSEMBL: ENSMUSP00000000811 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000811]
AlphaFold P58391
Predicted Effect probably damaging
Transcript: ENSMUST00000000811
AA Change: V185A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000000811
Gene: ENSMUSG00000000794
AA Change: V185A

DomainStartEndE-ValueType
low complexity region 30 96 N/A INTRINSIC
low complexity region 139 154 N/A INTRINSIC
low complexity region 213 224 N/A INTRINSIC
Pfam:SK_channel 270 383 3.1e-51 PFAM
Pfam:Ion_trans_2 462 548 2.2e-14 PFAM
CaMBD 562 638 1.04e-49 SMART
low complexity region 684 690 N/A INTRINSIC
low complexity region 718 731 N/A INTRINSIC
Meta Mutation Damage Score 0.0817 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Action potentials in vertebrate neurons are followed by an afterhyperpolarization (AHP) that may persist for several seconds and may have profound consequences for the firing pattern of the neuron. Each component of the AHP is kinetically distinct and is mediated by different calcium-activated potassium channels. This gene belongs to the KCNN family of potassium channels. It encodes an integral membrane protein that forms a voltage-independent calcium-activated channel, which is thought to regulate neuronal excitability by contributing to the slow component of synaptic AHP. This gene contains two CAG repeat regions in the coding sequence. It was thought that expansion of one or both of these repeats could lead to an increased susceptibility to schizophrenia or bipolar disorder, but studies indicate that this is probably not the case. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Feb 2011]
PHENOTYPE: Mice homozygous for an insertion of a tetracycline-regulated gene switch display no overt phenotype when expression is abolished by doxycycline treatment; in contrast, untreated homozygotes show abnormal respiratory responses to hypoxia, impaired parturition, and pregnancy-related premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 90,009,393 (GRCm39) D90G possibly damaging Het
Atp6v0a2 C T 5: 124,794,981 (GRCm39) T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 127,960,946 (GRCm39) probably null Het
Bsn C T 9: 107,985,385 (GRCm39) V2890M unknown Het
Bsn T C 9: 107,992,668 (GRCm39) E1028G probably damaging Het
Ccdc116 T C 16: 16,960,307 (GRCm39) H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,725,201 (GRCm39) probably benign Het
Cemip2 A G 19: 21,795,303 (GRCm39) D732G possibly damaging Het
Clpb A G 7: 101,372,035 (GRCm39) D257G probably benign Het
Crygs C T 16: 22,624,301 (GRCm39) G102D possibly damaging Het
Dlgap5 A G 14: 47,627,898 (GRCm39) probably null Het
Dmwd T C 7: 18,810,270 (GRCm39) F26L probably damaging Het
Eif5b T C 1: 38,057,100 (GRCm39) probably benign Het
Flii A G 11: 60,609,742 (GRCm39) Y622H probably damaging Het
Gbp7 A T 3: 142,240,333 (GRCm39) E17V probably benign Het
Ghrh T C 2: 157,173,797 (GRCm39) probably null Het
Gm20939 T A 17: 95,184,721 (GRCm39) H456Q probably damaging Het
Golga4 T A 9: 118,388,411 (GRCm39) S1844R possibly damaging Het
Hgd T C 16: 37,439,330 (GRCm39) F213L probably damaging Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Itga11 A G 9: 62,675,912 (GRCm39) probably benign Het
Lrriq1 T C 10: 103,050,536 (GRCm39) T739A probably benign Het
Mib1 C T 18: 10,760,831 (GRCm39) Q374* probably null Het
Myh9 A G 15: 77,697,384 (GRCm39) L10P probably damaging Het
Ncor2 A G 5: 125,132,855 (GRCm39) F44S probably damaging Het
Nr3c1 C A 18: 39,620,156 (GRCm39) A44S possibly damaging Het
Or10n1 G A 9: 39,525,060 (GRCm39) V66I probably benign Het
Or51a43 A G 7: 103,717,794 (GRCm39) V148A probably benign Het
Ovch2 A G 7: 107,389,596 (GRCm39) L317P possibly damaging Het
Pcolce2 T A 9: 95,576,767 (GRCm39) L346Q probably damaging Het
Rdm1 T A 11: 101,521,716 (GRCm39) L157H possibly damaging Het
Rptn A G 3: 93,306,015 (GRCm39) Y1116C possibly damaging Het
Scn7a A G 2: 66,530,551 (GRCm39) probably benign Het
Slc24a2 A G 4: 86,909,591 (GRCm39) V660A possibly damaging Het
Tet3 A G 6: 83,345,494 (GRCm39) S1648P probably damaging Het
Tmem198b G A 10: 128,638,062 (GRCm39) T167I probably damaging Het
Tmx1 T A 12: 70,512,895 (GRCm39) C268S probably benign Het
Ubr4 A G 4: 139,206,811 (GRCm39) N4886S possibly damaging Het
Usp47 A G 7: 111,692,405 (GRCm39) S956G probably damaging Het
Vmn2r60 T A 7: 41,790,459 (GRCm39) V482E probably damaging Het
Zfhx4 C T 3: 5,468,724 (GRCm39) P2986S probably damaging Het
Zfp507 T C 7: 35,494,224 (GRCm39) E273G probably damaging Het
Other mutations in Kcnn3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02263:Kcnn3 APN 3 89,568,525 (GRCm39) missense possibly damaging 0.73
IGL02444:Kcnn3 APN 3 89,559,359 (GRCm39) missense possibly damaging 0.50
IGL02500:Kcnn3 APN 3 89,568,419 (GRCm39) splice site probably benign
IGL02814:Kcnn3 APN 3 89,428,482 (GRCm39) missense possibly damaging 0.94
IGL02821:Kcnn3 APN 3 89,428,281 (GRCm39) missense possibly damaging 0.91
IGL02821:Kcnn3 APN 3 89,570,029 (GRCm39) missense possibly damaging 0.84
IGL02852:Kcnn3 APN 3 89,516,923 (GRCm39) missense probably damaging 0.96
IGL02942:Kcnn3 APN 3 89,559,383 (GRCm39) missense probably benign 0.00
IGL03118:Kcnn3 APN 3 89,574,468 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0015:Kcnn3 UTSW 3 89,570,080 (GRCm39) missense probably damaging 1.00
R0032:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R0370:Kcnn3 UTSW 3 89,574,399 (GRCm39) missense probably damaging 0.98
R0619:Kcnn3 UTSW 3 89,559,337 (GRCm39) missense probably damaging 1.00
R1167:Kcnn3 UTSW 3 89,472,259 (GRCm39) nonsense probably null
R1255:Kcnn3 UTSW 3 89,559,416 (GRCm39) missense possibly damaging 0.84
R1643:Kcnn3 UTSW 3 89,427,804 (GRCm39) missense unknown
R1733:Kcnn3 UTSW 3 89,559,397 (GRCm39) missense probably benign 0.00
R1793:Kcnn3 UTSW 3 89,516,712 (GRCm39) missense probably benign 0.20
R1827:Kcnn3 UTSW 3 89,428,301 (GRCm39) missense possibly damaging 0.75
R1899:Kcnn3 UTSW 3 89,427,762 (GRCm39) start gained probably benign
R2055:Kcnn3 UTSW 3 89,428,682 (GRCm39) missense probably damaging 1.00
R2843:Kcnn3 UTSW 3 89,427,972 (GRCm39) small deletion probably benign
R4078:Kcnn3 UTSW 3 89,568,495 (GRCm39) missense possibly damaging 0.68
R4227:Kcnn3 UTSW 3 89,428,482 (GRCm39) missense possibly damaging 0.94
R4604:Kcnn3 UTSW 3 89,427,727 (GRCm39) start gained probably benign
R4814:Kcnn3 UTSW 3 89,570,031 (GRCm39) missense probably damaging 1.00
R4822:Kcnn3 UTSW 3 89,574,596 (GRCm39) missense possibly damaging 0.93
R5175:Kcnn3 UTSW 3 89,516,746 (GRCm39) missense probably damaging 1.00
R5211:Kcnn3 UTSW 3 89,428,538 (GRCm39) missense probably benign 0.04
R5438:Kcnn3 UTSW 3 89,428,605 (GRCm39) missense probably damaging 1.00
R5496:Kcnn3 UTSW 3 89,516,797 (GRCm39) missense possibly damaging 0.95
R6244:Kcnn3 UTSW 3 89,552,830 (GRCm39) nonsense probably null
R7391:Kcnn3 UTSW 3 89,516,778 (GRCm39) missense probably benign 0.34
R7625:Kcnn3 UTSW 3 89,516,977 (GRCm39) missense probably damaging 0.99
R7834:Kcnn3 UTSW 3 89,428,661 (GRCm39) missense probably damaging 1.00
R8022:Kcnn3 UTSW 3 89,517,010 (GRCm39) missense possibly damaging 0.92
R8110:Kcnn3 UTSW 3 89,568,540 (GRCm39) missense probably damaging 0.99
R8220:Kcnn3 UTSW 3 89,568,548 (GRCm39) missense probably benign 0.14
R8787:Kcnn3 UTSW 3 89,552,757 (GRCm39) missense possibly damaging 0.93
R9124:Kcnn3 UTSW 3 89,428,536 (GRCm39) missense possibly damaging 0.47
R9256:Kcnn3 UTSW 3 89,574,407 (GRCm39) missense probably damaging 1.00
R9612:Kcnn3 UTSW 3 89,516,703 (GRCm39) missense probably benign 0.09
Z1088:Kcnn3 UTSW 3 89,574,437 (GRCm39) missense probably damaging 1.00
Z1177:Kcnn3 UTSW 3 89,568,443 (GRCm39) missense possibly damaging 0.72
Z1177:Kcnn3 UTSW 3 89,428,230 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGCAGCCAGCTAAATCTCAATG -3'
(R):5'- GTGTCCCAGCTTATAGCCAATG -3'

Sequencing Primer
(F):5'- AAATCTCAATGACCACTTGCTTGGC -3'
(R):5'- GTCCCAGCTTATAGCCAATGTTTTG -3'
Posted On 2014-12-29