Incidental Mutation 'R2922:Cdk11b'
ID255567
Institutional Source Beutler Lab
Gene Symbol Cdk11b
Ensembl Gene ENSMUSG00000029062
Gene Namecyclin-dependent kinase 11B
SynonymsPITSLRE proteins, CDK11-p110, Cdc2l1, Cdc2l2, CDK11-p46, CDK11-p58
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R2922 (G1)
Quality Score217
Status Validated
Chromosome4
Chromosomal Location155624854-155649938 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) CAGAAGAAG to CAGAAG at 155640744 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000111488 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067081] [ENSMUST00000105598] [ENSMUST00000105600] [ENSMUST00000115821]
Predicted Effect probably benign
Transcript: ENSMUST00000067081
SMART Domains Protein: ENSMUSP00000070527
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105598
SMART Domains Protein: ENSMUSP00000101223
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 59 78 N/A INTRINSIC
coiled coil region 89 180 N/A INTRINSIC
low complexity region 218 225 N/A INTRINSIC
low complexity region 227 238 N/A INTRINSIC
coiled coil region 256 303 N/A INTRINSIC
low complexity region 335 349 N/A INTRINSIC
S_TKc 393 678 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000105600
SMART Domains Protein: ENSMUSP00000101225
Gene: ENSMUSG00000029062

DomainStartEndE-ValueType
low complexity region 19 48 N/A INTRINSIC
low complexity region 93 112 N/A INTRINSIC
coiled coil region 123 214 N/A INTRINSIC
low complexity region 252 259 N/A INTRINSIC
low complexity region 261 272 N/A INTRINSIC
coiled coil region 290 337 N/A INTRINSIC
low complexity region 369 383 N/A INTRINSIC
S_TKc 427 712 5.05e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115821
SMART Domains Protein: ENSMUSP00000111488
Gene: ENSMUSG00000073682

DomainStartEndE-ValueType
SCOP:d1l9ha_ 17 52 2e-3 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142513
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the serine/threonine protein kinase family. Members of this kinase family are known to be essential for eukaryotic cell cycle control. Due to a segmental duplication, this gene shares very high sequence identity with a neighboring gene. These two genes are frequently deleted or altered in neuroblastoma. The protein kinase encoded by this gene can be cleaved by caspases and may play a role in cell apoptosis. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Sep 2015]
PHENOTYPE: Homozygous null embryos display embryonic lethality from cell cycle arrest. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Baz2a AGCGGCGGTACTTGCGGG AG 10: 128,125,077 probably null Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Cdk11b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01764:Cdk11b APN 4 155628803 missense possibly damaging 0.54
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0071:Cdk11b UTSW 4 155649423 unclassified probably benign
R0145:Cdk11b UTSW 4 155641619 intron probably benign
R0372:Cdk11b UTSW 4 155641500 intron probably benign
R0426:Cdk11b UTSW 4 155642512 intron probably benign
R0471:Cdk11b UTSW 4 155647542 unclassified probably benign
R0627:Cdk11b UTSW 4 155640772 intron probably benign
R1475:Cdk11b UTSW 4 155634217 missense probably damaging 1.00
R1611:Cdk11b UTSW 4 155641575 intron probably benign
R1719:Cdk11b UTSW 4 155648397 unclassified probably benign
R1750:Cdk11b UTSW 4 155628680 intron probably null
R2061:Cdk11b UTSW 4 155641604 intron probably benign
R2274:Cdk11b UTSW 4 155647594 unclassified probably benign
R3719:Cdk11b UTSW 4 155626886 missense probably damaging 1.00
R3917:Cdk11b UTSW 4 155626801 missense probably damaging 1.00
R4077:Cdk11b UTSW 4 155639747 intron probably benign
R4078:Cdk11b UTSW 4 155639747 intron probably benign
R5033:Cdk11b UTSW 4 155648825 unclassified probably benign
R5212:Cdk11b UTSW 4 155638615 intron probably null
R5556:Cdk11b UTSW 4 155634147 nonsense probably null
R5622:Cdk11b UTSW 4 155630217 missense probably damaging 1.00
R5927:Cdk11b UTSW 4 155648240 unclassified probably benign
R5975:Cdk11b UTSW 4 155648240 unclassified probably benign
R6276:Cdk11b UTSW 4 155634190 missense probably benign 0.11
R6278:Cdk11b UTSW 4 155649603 unclassified probably benign
R6905:Cdk11b UTSW 4 155641608 intron probably benign
R6998:Cdk11b UTSW 4 155648343 nonsense probably null
R7021:Cdk11b UTSW 4 155641567 intron probably benign
R7062:Cdk11b UTSW 4 155626811 missense probably damaging 1.00
R7100:Cdk11b UTSW 4 155625593 missense probably damaging 1.00
Z1088:Cdk11b UTSW 4 155641564 intron probably benign
Predicted Primers PCR Primer
(F):5'- AACTTGCCTTATTCTGTGAGACTC -3'
(R):5'- GGAACAGCTTCAATTTATGGGG -3'

Sequencing Primer
(F):5'- CAATAGTAAAGTGCTTGCCACCTTC -3'
(R):5'- GCTTCAATTTATGGGGTTATTACACG -3'
Posted On2014-12-29