Incidental Mutation 'R2922:Baz2a'
ID255585
Institutional Source Beutler Lab
Gene Symbol Baz2a
Ensembl Gene ENSMUSG00000040054
Gene Namebromodomain adjacent to zinc finger domain, 2A
SynonymsC030005G16Rik, Tip5, Walp3
MMRRC Submission 040507-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2922 (G1)
Quality Score170
Status Validated
Chromosome10
Chromosomal Location128091577-128129303 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) AGCGGCGGTACTTGCGGG to AG at 128125077 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000151961 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045621] [ENSMUST00000170054] [ENSMUST00000217851] [ENSMUST00000220049]
Predicted Effect probably null
Transcript: ENSMUST00000045621
SMART Domains Protein: ENSMUSP00000044359
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 342 353 N/A INTRINSIC
low complexity region 421 475 N/A INTRINSIC
low complexity region 518 529 N/A INTRINSIC
MBD 539 614 3.87e-35 SMART
AT_hook 639 651 2.38e0 SMART
AT_hook 660 672 1.65e0 SMART
low complexity region 697 710 N/A INTRINSIC
coiled coil region 736 776 N/A INTRINSIC
DDT 837 902 3.75e-18 SMART
Pfam:WHIM1 939 988 4.8e-8 PFAM
low complexity region 1001 1013 N/A INTRINSIC
AT_hook 1174 1186 6.23e1 SMART
AT_hook 1388 1400 4.21e0 SMART
Pfam:WHIM3 1423 1464 1e-9 PFAM
PHD 1662 1708 1.47e-11 SMART
low complexity region 1741 1753 N/A INTRINSIC
BROMO 1773 1881 7.71e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000170054
SMART Domains Protein: ENSMUSP00000129803
Gene: ENSMUSG00000040054

DomainStartEndE-ValueType
low complexity region 73 82 N/A INTRINSIC
low complexity region 181 192 N/A INTRINSIC
low complexity region 343 354 N/A INTRINSIC
low complexity region 422 476 N/A INTRINSIC
low complexity region 519 530 N/A INTRINSIC
MBD 540 615 3.87e-35 SMART
AT_hook 640 652 2.38e0 SMART
AT_hook 661 673 1.65e0 SMART
low complexity region 698 711 N/A INTRINSIC
coiled coil region 737 777 N/A INTRINSIC
DDT 838 903 3.75e-18 SMART
Pfam:WHIM1 940 989 4.8e-8 PFAM
low complexity region 1002 1014 N/A INTRINSIC
AT_hook 1175 1187 6.23e1 SMART
AT_hook 1389 1401 4.21e0 SMART
Pfam:WHIM3 1424 1462 5.5e-19 PFAM
PHD 1663 1709 1.47e-11 SMART
low complexity region 1742 1754 N/A INTRINSIC
BROMO 1774 1882 7.71e-41 SMART
Predicted Effect probably null
Transcript: ENSMUST00000217851
Predicted Effect probably null
Transcript: ENSMUST00000220049
Meta Mutation Damage Score 0.6392 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 100% (43/43)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Bsn C T 9: 108,108,186 V2890M unknown Het
Bsn T C 9: 108,115,469 E1028G probably damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Cdk11b CAGAAGAAG CAGAAG 4: 155,640,744 probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Crygs C T 16: 22,805,551 G102D possibly damaging Het
Dlgap5 A G 14: 47,390,441 probably null Het
Dmwd T C 7: 19,076,345 F26L probably damaging Het
Eif5b T C 1: 38,018,019 probably benign Het
Flii A G 11: 60,718,916 Y622H probably damaging Het
Gbp7 A T 3: 142,534,572 E17V probably benign Het
Ghrh T C 2: 157,331,877 probably null Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Hgd T C 16: 37,618,968 F213L probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Itga11 A G 9: 62,768,630 probably benign Het
Kcnn3 T C 3: 89,521,022 V185A probably damaging Het
Lrriq1 T C 10: 103,214,675 T739A probably benign Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Myh9 A G 15: 77,813,184 L10P probably damaging Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nr3c1 C A 18: 39,487,103 A44S possibly damaging Het
Olfr148 G A 9: 39,613,764 V66I probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pcolce2 T A 9: 95,694,714 L346Q probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Scn7a A G 2: 66,700,207 probably benign Het
Slc24a2 A G 4: 86,991,354 V660A possibly damaging Het
Tet3 A G 6: 83,368,512 S1648P probably damaging Het
Tmem198b G A 10: 128,802,193 T167I probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ubr4 A G 4: 139,479,500 N4886S possibly damaging Het
Usp47 A G 7: 112,093,198 S956G probably damaging Het
Vmn2r60 T A 7: 42,141,035 V482E probably damaging Het
Zfhx4 C T 3: 5,403,664 P2986S probably damaging Het
Zfp507 T C 7: 35,794,799 E273G probably damaging Het
Other mutations in Baz2a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00228:Baz2a APN 10 128124935 missense probably benign 0.00
IGL00501:Baz2a APN 10 128114625 missense probably benign 0.14
IGL00743:Baz2a APN 10 128114526 missense probably benign
IGL01362:Baz2a APN 10 128121964 missense probably damaging 0.98
IGL01394:Baz2a APN 10 128118645 missense possibly damaging 0.46
IGL01603:Baz2a APN 10 128111168 missense probably damaging 0.98
IGL02165:Baz2a APN 10 128119349 missense probably benign 0.03
IGL02732:Baz2a APN 10 128125175 missense possibly damaging 0.66
IGL03030:Baz2a APN 10 128125146 missense possibly damaging 0.62
IGL03087:Baz2a APN 10 128122313 missense probably damaging 0.99
R0255:Baz2a UTSW 10 128114639 missense possibly damaging 0.66
R0737:Baz2a UTSW 10 128116080 missense possibly damaging 0.92
R0742:Baz2a UTSW 10 128113666 nonsense probably null
R0755:Baz2a UTSW 10 128119691 missense possibly damaging 0.92
R0798:Baz2a UTSW 10 128126323 splice site probably benign
R0879:Baz2a UTSW 10 128121304 missense probably damaging 0.99
R1023:Baz2a UTSW 10 128121807 missense possibly damaging 0.66
R1482:Baz2a UTSW 10 128109008 missense possibly damaging 0.92
R1512:Baz2a UTSW 10 128124152 missense possibly damaging 0.95
R1658:Baz2a UTSW 10 128124383 missense probably benign 0.04
R1983:Baz2a UTSW 10 128123959 missense probably benign 0.14
R2059:Baz2a UTSW 10 128113578 missense probably damaging 0.98
R2141:Baz2a UTSW 10 128123612 missense probably damaging 1.00
R2921:Baz2a UTSW 10 128125077 frame shift probably null
R3104:Baz2a UTSW 10 128125077 frame shift probably null
R3105:Baz2a UTSW 10 128125077 frame shift probably null
R3106:Baz2a UTSW 10 128125077 frame shift probably null
R3621:Baz2a UTSW 10 128125077 frame shift probably null
R3872:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3873:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R3875:Baz2a UTSW 10 128124110 missense probably damaging 1.00
R4600:Baz2a UTSW 10 128121183 missense probably damaging 0.97
R4692:Baz2a UTSW 10 128124893 missense probably damaging 1.00
R4717:Baz2a UTSW 10 128124942 missense possibly damaging 0.83
R4821:Baz2a UTSW 10 128111109 missense probably damaging 1.00
R4832:Baz2a UTSW 10 128123130 missense probably benign 0.08
R4893:Baz2a UTSW 10 128123415 missense possibly damaging 0.66
R4907:Baz2a UTSW 10 128110808 missense probably damaging 0.99
R5133:Baz2a UTSW 10 128116126 missense probably damaging 1.00
R5340:Baz2a UTSW 10 128115042 missense probably damaging 1.00
R5527:Baz2a UTSW 10 128124917 missense probably damaging 1.00
R5761:Baz2a UTSW 10 128119690 missense possibly damaging 0.66
R5891:Baz2a UTSW 10 128121322 missense probably damaging 1.00
R6088:Baz2a UTSW 10 128114642 small deletion probably benign
R6089:Baz2a UTSW 10 128114642 small deletion probably benign
R6323:Baz2a UTSW 10 128126417 missense probably benign 0.21
R6894:Baz2a UTSW 10 128123581 missense possibly damaging 0.81
R7101:Baz2a UTSW 10 128121187 missense possibly damaging 0.66
R7178:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7179:Baz2a UTSW 10 128124457 missense probably damaging 0.98
R7202:Baz2a UTSW 10 128118559 missense possibly damaging 0.54
R7223:Baz2a UTSW 10 128112606 missense probably damaging 1.00
R7268:Baz2a UTSW 10 128124221 missense possibly damaging 0.66
R7426:Baz2a UTSW 10 128116078 missense probably damaging 1.00
R7464:Baz2a UTSW 10 128122073 missense possibly damaging 0.81
Predicted Primers PCR Primer
(F):5'- TCATGACATGCAGTGTTTCCC -3'
(R):5'- CATGTGAGGAATACGCTTTTGTC -3'

Sequencing Primer
(F):5'- GACATGCAGTGTTTCCCTTTACAATG -3'
(R):5'- AGGAATACGCTTTTGTCTTGCC -3'
Posted On2014-12-29