Incidental Mutation 'R0318:C3'
ID25560
Institutional Source Beutler Lab
Gene Symbol C3
Ensembl Gene ENSMUSG00000024164
Gene Namecomplement component 3
Synonymscomplement factor 3, acylation stimulating protein, Plp
MMRRC Submission 038528-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0318 (G1)
Quality Score225
Status Not validated
Chromosome17
Chromosomal Location57203970-57228136 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 57224709 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 272 (V272M)
Ref Sequence ENSEMBL: ENSMUSP00000024988 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024988] [ENSMUST00000177425]
Predicted Effect probably damaging
Transcript: ENSMUST00000024988
AA Change: V272M

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000024988
Gene: ENSMUSG00000024164
AA Change: V272M

DomainStartEndE-ValueType
low complexity region 4 23 N/A INTRINSIC
Pfam:A2M_N 130 225 3.8e-17 PFAM
A2M_N_2 456 604 5.22e-38 SMART
ANATO 693 728 5.69e-15 SMART
low complexity region 752 762 N/A INTRINSIC
A2M 770 866 5.47e-32 SMART
Pfam:Thiol-ester_cl 1000 1028 4.6e-15 PFAM
Pfam:A2M_comp 1051 1284 7.3e-60 PFAM
A2M_recep 1398 1493 3.98e-43 SMART
C345C 1533 1645 1.85e-48 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000176457
Predicted Effect probably benign
Transcript: ENSMUST00000177046
Predicted Effect probably benign
Transcript: ENSMUST00000177425
SMART Domains Protein: ENSMUSP00000135663
Gene: ENSMUSG00000024164

DomainStartEndE-ValueType
Pfam:A2M_N_2 1 55 1.6e-10 PFAM
PDB:3L5N|B 74 102 1e-9 PDB
Coding Region Coverage
  • 1x: 98.8%
  • 3x: 97.7%
  • 10x: 94.4%
  • 20x: 86.5%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes complement protein C3 which plays a central role in the classical, alternative and lectin activation pathways of the complement system. The encoded preproprotein undergoes a multi-step processing to generate various functional peptides. Mice deficient in the encoded protein fail to clear bacteria from the blood stream upon infection, display diminished airway hyperresponsiveness and lung eosinophilia upon allergen-induced pulmonary allergy, and develop severe lung injury after deposition of IgG immune complexes. Deficiency of the homolog of the encoded protein in humans was found to be associated with increased susceptibility to infections, age-related macular degeneration, and atypical hemolytic uremic syndrome. [provided by RefSeq, Mar 2015]
PHENOTYPE: Homozygous mutant mice exhibit abnormal immune responses, including increased mortality upon bacterial infection and decreased inflammatory response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 54 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
9130401M01Rik A T 15: 58,028,974 L79Q probably damaging Het
Add1 T C 5: 34,625,340 V130A probably damaging Het
Ankrd23 G T 1: 36,534,072 T73K probably benign Het
BC005561 T C 5: 104,517,753 F47S probably benign Het
Blk A G 14: 63,374,197 Y430H probably damaging Het
Cerk C T 15: 86,151,565 A254T possibly damaging Het
Ces2a G A 8: 104,740,824 A494T probably damaging Het
Cfap46 T C 7: 139,654,566 Y258C probably damaging Het
Chaf1a C T 17: 56,062,227 T486I possibly damaging Het
Colec12 A G 18: 9,848,446 N208S possibly damaging Het
Coro7 T A 16: 4,675,807 H63L probably benign Het
Cps1 T A 1: 67,177,014 W833R probably damaging Het
Csmd3 A T 15: 47,659,153 W2707R probably damaging Het
Dbn1 C T 13: 55,474,916 E585K probably damaging Het
Ddx50 A T 10: 62,642,837 I190K probably damaging Het
Dnmt3l G A 10: 78,055,055 V264M probably damaging Het
Dnpep A G 1: 75,316,626 V33A probably damaging Het
Fam163a A G 1: 156,079,969 C26R probably damaging Het
Fam83h A G 15: 76,003,629 S620P probably benign Het
Fcna A G 2: 25,625,059 S263P probably benign Het
Fnip2 A T 3: 79,512,378 S165R probably damaging Het
Fpr-rs3 T C 17: 20,624,148 T244A probably benign Het
Gpr152 T C 19: 4,143,542 S361P possibly damaging Het
Grm5 A T 7: 87,602,967 I142L probably damaging Het
Gucy2g A G 19: 55,237,798 S229P probably benign Het
Htr7 C T 19: 35,969,486 G376D probably damaging Het
Irgc1 T C 7: 24,432,471 D307G probably benign Het
Irs1 A T 1: 82,288,660 S612T probably benign Het
Maml2 C T 9: 13,620,594 T368I probably damaging Het
Mapkapk2 A G 1: 131,097,335 V64A probably damaging Het
Marf1 C T 16: 14,142,534 A549T probably damaging Het
Nptx1 C T 11: 119,542,541 E411K probably damaging Het
Olfr372 C T 8: 72,058,400 T240M probably damaging Het
Olfr995 C A 2: 85,438,237 R307M possibly damaging Het
Pcgf5 A T 19: 36,412,190 K22N possibly damaging Het
Psmd9 C A 5: 123,234,649 A65E possibly damaging Het
Sh3bp1 A G 15: 78,911,707 T679A probably damaging Het
Sipa1l2 G A 8: 125,447,697 P1281S possibly damaging Het
Slc17a3 C T 13: 23,855,858 S293F probably damaging Het
Slc25a24 A G 3: 109,157,000 M222V probably benign Het
Smg9 T C 7: 24,420,888 F429S possibly damaging Het
Snapc1 C T 12: 73,975,032 R81C probably damaging Het
Sorl1 T A 9: 42,081,954 Y258F probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Stc1 A T 14: 69,038,418 Q220L probably damaging Het
Tas2r122 T C 6: 132,711,832 T33A possibly damaging Het
Tbc1d10b A G 7: 127,199,034 L645P probably damaging Het
Timd4 T A 11: 46,837,071 H272Q probably benign Het
Ttll5 T G 12: 85,876,594 probably null Het
Veph1 G T 3: 66,057,259 S783Y probably damaging Het
Vmn1r230 T C 17: 20,846,816 L89S possibly damaging Het
Xcr1 A G 9: 123,856,154 V165A possibly damaging Het
Zfp286 T C 11: 62,784,962 D58G probably damaging Het
Zfyve26 C T 12: 79,276,281 R897H probably damaging Het
Other mutations in C3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00332:C3 APN 17 57226004 missense probably benign 0.01
IGL00741:C3 APN 17 57220206 intron probably benign
IGL01093:C3 APN 17 57223949 missense probably damaging 1.00
IGL01309:C3 APN 17 57209652 intron probably benign
IGL01312:C3 APN 17 57225993 unclassified probably benign
IGL01344:C3 APN 17 57224880 missense probably benign
IGL01514:C3 APN 17 57215866 missense probably benign 0.04
IGL01913:C3 APN 17 57213767 missense probably null 0.01
IGL02165:C3 APN 17 57225092 missense probably benign 0.17
IGL02176:C3 APN 17 57226337 unclassified probably benign
IGL02189:C3 APN 17 57220113 missense probably benign 0.01
IGL02378:C3 APN 17 57212698 missense probably benign 0.19
IGL02422:C3 APN 17 57226823 missense probably damaging 0.98
IGL02715:C3 APN 17 57204158 intron probably benign
IGL02737:C3 APN 17 57204281 missense probably benign 0.08
IGL03201:C3 APN 17 57222249 missense probably damaging 1.00
IGL03210:C3 APN 17 57215846 nonsense probably null
IGL03345:C3 APN 17 57219585 missense probably damaging 1.00
PIT4431001:C3 UTSW 17 57206242 missense probably benign 0.00
PIT4494001:C3 UTSW 17 57209263 missense probably benign 0.01
R0158:C3 UTSW 17 57224851 critical splice donor site probably null
R1132:C3 UTSW 17 57207531 critical splice donor site probably null
R1765:C3 UTSW 17 57224401 intron probably null
R1793:C3 UTSW 17 57219592 missense possibly damaging 0.93
R1852:C3 UTSW 17 57222823 missense probably damaging 0.98
R1908:C3 UTSW 17 57209489 missense probably damaging 1.00
R1919:C3 UTSW 17 57220135 missense probably damaging 1.00
R1935:C3 UTSW 17 57218829 missense probably damaging 1.00
R2026:C3 UTSW 17 57218562 missense probably damaging 1.00
R2108:C3 UTSW 17 57223974 intron probably null
R2197:C3 UTSW 17 57219623 missense probably benign 0.32
R2394:C3 UTSW 17 57222303 nonsense probably null
R2998:C3 UTSW 17 57210284 missense probably benign 0.00
R3727:C3 UTSW 17 57207379 missense possibly damaging 0.50
R3767:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3768:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3769:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3770:C3 UTSW 17 57205303 missense possibly damaging 0.96
R3784:C3 UTSW 17 57226067 missense probably damaging 0.99
R3883:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3884:C3 UTSW 17 57217173 critical splice acceptor site probably null
R3950:C3 UTSW 17 57225286 missense probably benign 0.02
R3966:C3 UTSW 17 57218664 missense probably damaging 0.99
R4077:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4078:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4079:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4168:C3 UTSW 17 57218608 missense probably benign 0.00
R4208:C3 UTSW 17 57205303 missense possibly damaging 0.96
R4695:C3 UTSW 17 57221057 missense probably benign
R4909:C3 UTSW 17 57226830 critical splice donor site probably null
R5011:C3 UTSW 17 57223236 missense probably benign 0.06
R5094:C3 UTSW 17 57225033 critical splice donor site probably null
R5141:C3 UTSW 17 57219570 missense probably damaging 0.98
R5170:C3 UTSW 17 57223938 missense probably damaging 0.96
R5339:C3 UTSW 17 57224308 missense probably damaging 0.99
R5369:C3 UTSW 17 57221159 missense probably benign 0.45
R5412:C3 UTSW 17 57220187 missense probably benign 0.01
R5439:C3 UTSW 17 57204502 missense probably benign 0.28
R5463:C3 UTSW 17 57211720 missense probably benign 0.08
R5546:C3 UTSW 17 57222976 missense probably damaging 0.99
R5572:C3 UTSW 17 57224673 missense probably damaging 0.99
R5851:C3 UTSW 17 57211612 missense probably null 0.14
R5863:C3 UTSW 17 57223141 missense probably benign 0.06
R5888:C3 UTSW 17 57214831 missense probably damaging 1.00
R5940:C3 UTSW 17 57210244 missense possibly damaging 0.64
R6073:C3 UTSW 17 57206223 missense probably null
R6091:C3 UTSW 17 57221967 nonsense probably null
R6286:C3 UTSW 17 57224118 missense probably damaging 1.00
R6524:C3 UTSW 17 57217264 critical splice donor site probably null
R6868:C3 UTSW 17 57204029 missense possibly damaging 0.55
R6896:C3 UTSW 17 57220864 intron probably null
R7007:C3 UTSW 17 57218809 missense probably benign 0.00
R7022:C3 UTSW 17 57217286 missense probably damaging 1.00
R7099:C3 UTSW 17 57206276 missense probably benign 0.28
R7117:C3 UTSW 17 57212655 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GTTCAGCAAGGTGAGTGACTGGTAG -3'
(R):5'- TCTCCGCAGAGTTTGAGGTGAAGG -3'

Sequencing Primer
(F):5'- TGACTGGTAGGGGCACTAAG -3'
(R):5'- AGCCACACCCAGAGAAGTCT -3'
Posted On2013-04-16