Incidental Mutation 'R2923:Fhl3'
ID255612
Institutional Source Beutler Lab
Gene Symbol Fhl3
Ensembl Gene ENSMUSG00000032643
Gene Namefour and a half LIM domains 3
Synonyms
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.275) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location124700701-124708611 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 124705670 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 13 (S13P)
Ref Sequence ENSEMBL: ENSMUSP00000121702 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000038684] [ENSMUST00000106199] [ENSMUST00000145942]
Predicted Effect possibly damaging
Transcript: ENSMUST00000038684
AA Change: S13P

PolyPhen 2 Score 0.944 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000040150
Gene: ENSMUSG00000032643
AA Change: S13P

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 284 2.91e-16 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106199
AA Change: S13P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000101805
Gene: ENSMUSG00000032643
AA Change: S13P

DomainStartEndE-ValueType
LIM 39 92 2.7e-11 SMART
LIM 100 153 1.67e-16 SMART
LIM 161 212 4.48e-17 SMART
LIM 220 275 8.49e-18 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000145942
AA Change: S13P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000121702
Gene: ENSMUSG00000032643
AA Change: S13P

DomainStartEndE-ValueType
Blast:LIM 1 31 5e-6 BLAST
LIM 39 92 2.7e-11 SMART
Meta Mutation Damage Score 0.142 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of a family of proteins containing a four-and-a-half LIM domain, which is a highly conserved double zinc finger motif. The encoded protein has been shown to interact with the cancer developmental regulators SMAD2, SMAD3, and SMAD4, the skeletal muscle myogenesis protein MyoD, and the high-affinity IgE beta chain regulator MZF-1. This protein may be involved in tumor suppression, repression of MyoD expression, and repression of IgE receptor expression. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Aug 2011]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Fhl3
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0592:Fhl3 UTSW 4 124705677 missense probably benign 0.23
R1118:Fhl3 UTSW 4 124705791 critical splice donor site probably null
R2402:Fhl3 UTSW 4 124705688 missense probably damaging 1.00
R2921:Fhl3 UTSW 4 124705670 missense probably damaging 1.00
R4583:Fhl3 UTSW 4 124707549 missense probably benign 0.41
R5147:Fhl3 UTSW 4 124707931 missense probably benign 0.01
R5460:Fhl3 UTSW 4 124706003 missense probably damaging 1.00
R5932:Fhl3 UTSW 4 124705727 missense probably damaging 1.00
R6855:Fhl3 UTSW 4 124707522 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- ACATGCTCTGACCTGGCATC -3'
(R):5'- CCTCATAGAACAGTTCCTTCGG -3'

Sequencing Primer
(F):5'- ATGCTCTGACCTGGCATCTTCTATG -3'
(R):5'- AACAGTTCCTTCGGGGAGAC -3'
Posted On2014-12-29