Incidental Mutation 'R2923:Nipal3'
ID255613
Institutional Source Beutler Lab
Gene Symbol Nipal3
Ensembl Gene ENSMUSG00000028803
Gene NameNIPA-like domain containing 3
Synonyms9130020G22Rik, Npal3
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.098) question?
Stock #R2923 (G1)
Quality Score225
Status Not validated
Chromosome4
Chromosomal Location135445420-135495038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 135477465 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Asparagine at position 125 (I125N)
Ref Sequence ENSEMBL: ENSMUSP00000139088 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102549] [ENSMUST00000105856] [ENSMUST00000145020] [ENSMUST00000183807]
Predicted Effect probably damaging
Transcript: ENSMUST00000102549
AA Change: I125N

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000099608
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 5e-75 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000105856
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000101482
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
low complexity region 13 33 N/A INTRINSIC
Pfam:Mg_trans_NIPA 35 330 9.5e-75 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000140982
SMART Domains Protein: ENSMUSP00000118178
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 1 190 1.2e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000145020
SMART Domains Protein: ENSMUSP00000118122
Gene: ENSMUSG00000028803

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 107 4.7e-19 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000183807
AA Change: I125N

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000139088
Gene: ENSMUSG00000028803
AA Change: I125N

DomainStartEndE-ValueType
Pfam:Mg_trans_NIPA 33 333 3.8e-75 PFAM
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit gender-dependent behavioral and immune system abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Nipal3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Nipal3 APN 4 135468593 missense possibly damaging 0.90
IGL01338:Nipal3 APN 4 135471883 critical splice donor site probably null
IGL02149:Nipal3 APN 4 135466852 missense possibly damaging 0.67
IGL02160:Nipal3 APN 4 135474417 nonsense probably null
IGL02560:Nipal3 APN 4 135479704 missense probably damaging 1.00
IGL02826:Nipal3 APN 4 135468550 nonsense probably null
IGL02868:Nipal3 APN 4 135466871 missense probably damaging 1.00
R0189:Nipal3 UTSW 4 135468518 missense possibly damaging 0.89
R0470:Nipal3 UTSW 4 135447372 missense probably damaging 0.99
R0891:Nipal3 UTSW 4 135468587 missense possibly damaging 0.91
R1633:Nipal3 UTSW 4 135447348 missense probably benign 0.03
R1686:Nipal3 UTSW 4 135447288 missense possibly damaging 0.49
R2921:Nipal3 UTSW 4 135477465 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3732:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3733:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R3734:Nipal3 UTSW 4 135463846 missense probably damaging 1.00
R5057:Nipal3 UTSW 4 135466856 missense probably damaging 1.00
R5616:Nipal3 UTSW 4 135452404 missense probably benign 0.01
R5758:Nipal3 UTSW 4 135452563 missense probably benign 0.02
R5779:Nipal3 UTSW 4 135452339 intron probably benign
R5885:Nipal3 UTSW 4 135471977 missense probably damaging 0.97
R6572:Nipal3 UTSW 4 135447253 missense probably benign 0.02
R6981:Nipal3 UTSW 4 135479547 missense probably damaging 1.00
R7194:Nipal3 UTSW 4 135474421 missense probably benign 0.26
X0066:Nipal3 UTSW 4 135447255 missense probably benign 0.02
Predicted Primers PCR Primer
(F):5'- CAATTCTGATGGGTAGCTGGGC -3'
(R):5'- CACAGAAGGCTCTAGAAGGTC -3'

Sequencing Primer
(F):5'- GCTTGGGTTATTTAATGTTAACATCC -3'
(R):5'- GAAGGCTCTAGAAGGTCCCCAC -3'
Posted On2014-12-29