Incidental Mutation 'R2923:Rpl22'
ID 255614
Institutional Source Beutler Lab
Gene Symbol Rpl22
Ensembl Gene ENSMUSG00000028936
Gene Name ribosomal protein L22
Synonyms 2700038K18Rik
MMRRC Submission 040508-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R2923 (G1)
Quality Score 225
Status Validated
Chromosome 4
Chromosomal Location 152410199-152418528 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 152412002 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Threonine to Asparagine at position 26 (T26N)
Ref Sequence ENSEMBL: ENSMUSP00000140276 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000103191] [ENSMUST00000139685] [ENSMUST00000188151]
AlphaFold P67984
Predicted Effect possibly damaging
Transcript: ENSMUST00000103191
AA Change: T26N

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000099480
Gene: ENSMUSG00000028936
AA Change: T26N

DomainStartEndE-ValueType
Pfam:Ribosomal_L22e 16 124 6.9e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126519
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127659
Predicted Effect possibly damaging
Transcript: ENSMUST00000139685
AA Change: T26N

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000118787
Gene: ENSMUSG00000028936
AA Change: T26N

DomainStartEndE-ValueType
Pfam:Ribosomal_L22e 13 127 1.3e-57 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142735
Predicted Effect noncoding transcript
Transcript: ENSMUST00000150485
Predicted Effect noncoding transcript
Transcript: ENSMUST00000156445
Predicted Effect possibly damaging
Transcript: ENSMUST00000188151
AA Change: T26N

PolyPhen 2 Score 0.902 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000140276
Gene: ENSMUSG00000028936
AA Change: T26N

DomainStartEndE-ValueType
Pfam:Ribosomal_L22e 13 127 1.3e-57 PFAM
Meta Mutation Damage Score 0.2576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Ribosomes, the organelles that catalyze protein synthesis, consist of a small 40S subunit and a large 60S subunit. Together these subunits are composed of 4 RNA species and approximately 80 structurally distinct proteins. This gene encodes a cytoplasmic ribosomal protein that is a component of the 60S subunit. The protein belongs to the L22E family of ribosomal proteins. Its initiating methionine residue is post-translationally removed. The protein can bind specifically to Epstein-Barr virus-encoded RNAs (EBERs) 1 and 2. The mouse protein has been shown to be capable of binding to heparin. Transcript variants utilizing alternative polyA signals exist. As is typical for genes encoding ribosomal proteins, there are multiple processed pseudogenes of this gene dispersed through the genome. It was previously thought that this gene mapped to 3q26 and that it was fused to the acute myeloid leukemia 1 (AML1) gene located at 21q22 in some therapy-related myelodysplastic syndrome patients with 3;21 translocations; however, these fusions actually involve a ribosomal protein L22 pseudogene located at 3q26, and this gene actually maps to 1p36.3-p36.2. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele exhibit arrested alpha beta lineage T cell differentiation at the beta selection stage. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,467,518 (GRCm39) C368S probably damaging Het
Adamts3 T C 5: 90,009,393 (GRCm39) D90G possibly damaging Het
Astn2 T C 4: 65,832,010 (GRCm39) Y500C probably damaging Het
Atp12a A T 14: 56,612,079 (GRCm39) T418S probably benign Het
Atp6v0a2 C T 5: 124,794,981 (GRCm39) T656M possibly damaging Het
Camsap2 G A 1: 136,208,547 (GRCm39) P971S possibly damaging Het
Ccdc116 T C 16: 16,960,307 (GRCm39) H170R probably benign Het
Ccn5 G A 2: 163,674,266 (GRCm39) R222Q probably benign Het
Cemip2 A G 19: 21,795,303 (GRCm39) D732G possibly damaging Het
Clpb A G 7: 101,372,035 (GRCm39) D257G probably benign Het
Cpb2 T C 14: 75,493,473 (GRCm39) probably null Het
D430041D05Rik G A 2: 104,085,660 (GRCm39) T164I possibly damaging Het
Dhx40 T G 11: 86,680,089 (GRCm39) Q416P probably benign Het
Dnah17 A G 11: 117,984,373 (GRCm39) F1636S probably damaging Het
Fhl3 T C 4: 124,599,463 (GRCm39) S13P probably damaging Het
Gapvd1 A T 2: 34,578,875 (GRCm39) I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 (GRCm39) A61T unknown Het
Gm20939 T A 17: 95,184,721 (GRCm39) H456Q probably damaging Het
Golga4 T A 9: 118,388,411 (GRCm39) S1844R possibly damaging Het
Grm6 G C 11: 50,755,348 (GRCm39) G827R probably damaging Het
Grm7 T A 6: 111,472,866 (GRCm39) probably null Het
Hdc G A 2: 126,435,910 (GRCm39) P654S probably damaging Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Ipo9 G T 1: 135,327,867 (GRCm39) Q515K probably benign Het
Kcnk3 T C 5: 30,779,414 (GRCm39) S155P probably damaging Het
Mboat2 T A 12: 25,004,239 (GRCm39) W347R probably damaging Het
Mib1 C T 18: 10,760,831 (GRCm39) Q374* probably null Het
Ncor2 A G 5: 125,132,855 (GRCm39) F44S probably damaging Het
Nipal3 A T 4: 135,204,776 (GRCm39) I125N probably damaging Het
Or4c113 A G 2: 88,884,843 (GRCm39) V309A probably benign Het
Or51a43 A G 7: 103,717,794 (GRCm39) V148A probably benign Het
Ovch2 A G 7: 107,389,596 (GRCm39) L317P possibly damaging Het
Pnpla2 T A 7: 141,035,380 (GRCm39) C61S probably benign Het
Ppp1r16b G T 2: 158,598,877 (GRCm39) L312F probably damaging Het
Rdm1 T A 11: 101,521,716 (GRCm39) L157H possibly damaging Het
Rptn A G 3: 93,306,015 (GRCm39) Y1116C possibly damaging Het
Serpinb5 G A 1: 106,803,770 (GRCm39) S152N probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
St8sia1 A T 6: 142,774,963 (GRCm39) F205L probably damaging Het
Stab2 A G 10: 86,697,325 (GRCm39) Y1988H probably damaging Het
Susd3 A T 13: 49,401,945 (GRCm39) M1K probably null Het
Syne3 A T 12: 104,934,343 (GRCm39) L55Q probably damaging Het
Tmx1 T A 12: 70,512,895 (GRCm39) C268S probably benign Het
Ttll1 T C 15: 83,376,760 (GRCm39) K321R probably damaging Het
Zdhhc18 G T 4: 133,360,455 (GRCm39) H82Q probably benign Het
Zhx1 T C 15: 57,917,077 (GRCm39) I390V probably damaging Het
Other mutations in Rpl22
AlleleSourceChrCoordTypePredicted EffectPPH Score
R2921:Rpl22 UTSW 4 152,412,002 (GRCm39) missense possibly damaging 0.90
R5594:Rpl22 UTSW 4 152,410,259 (GRCm39) unclassified probably benign
R6225:Rpl22 UTSW 4 152,414,536 (GRCm39) missense probably benign 0.07
R8177:Rpl22 UTSW 4 152,411,968 (GRCm39) missense probably damaging 0.96
R8680:Rpl22 UTSW 4 152,416,763 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGAAGGGAGTCCATCTGTTTCC -3'
(R):5'- TCTATCTCAAGAGATGCAGCAAC -3'

Sequencing Primer
(F):5'- GGTAAGGACTTTCATGACTCTGAC -3'
(R):5'- CAAATACTTAATCTGCCCTGGC -3'
Posted On 2014-12-29