Incidental Mutation 'R2923:Adamts3'
ID 255616
Institutional Source Beutler Lab
Gene Symbol Adamts3
Ensembl Gene ENSMUSG00000043635
Gene Name ADAM metallopeptidase with thrombospondin type 1 motif 3
Synonyms 1100001H14Rik, 6330442E02Rik
MMRRC Submission 040508-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R2923 (G1)
Quality Score 225
Status Validated
Chromosome 5
Chromosomal Location 89824946-90031193 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 90009393 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 90 (D90G)
Ref Sequence ENSEMBL: ENSMUSP00000058552 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061427] [ENSMUST00000163159] [ENSMUST00000198151]
AlphaFold E9Q287
Predicted Effect possibly damaging
Transcript: ENSMUST00000061427
AA Change: D90G

PolyPhen 2 Score 0.901 (Sensitivity: 0.82; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000058552
Gene: ENSMUSG00000043635
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 201 5.1e-40 PFAM
Pfam:Reprolysin_5 254 439 5.4e-15 PFAM
Pfam:Reprolysin_4 256 454 1.9e-10 PFAM
Pfam:Reprolysin 257 460 3.6e-22 PFAM
Pfam:Reprolysin_2 274 451 7.7e-13 PFAM
Pfam:Reprolysin_3 278 409 1.5e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 827 3e-34 PFAM
TSP1 848 905 4.35e-2 SMART
TSP1 908 967 4.95e-2 SMART
TSP1 969 1016 6.58e-5 SMART
low complexity region 1114 1128 N/A INTRINSIC
low complexity region 1157 1177 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163159
AA Change: D90G

PolyPhen 2 Score 0.367 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000132219
Gene: ENSMUSG00000043635
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 43 201 1.5e-40 PFAM
Pfam:Reprolysin_5 254 439 2.2e-15 PFAM
Pfam:Reprolysin_4 256 454 7.7e-11 PFAM
Pfam:Reprolysin 257 460 3.7e-21 PFAM
Pfam:Reprolysin_2 274 451 4.3e-14 PFAM
Pfam:Reprolysin_3 278 409 1.3e-12 PFAM
TSP1 554 606 1.26e-15 SMART
Pfam:ADAM_spacer1 713 828 3.6e-28 PFAM
TSP1 849 906 4.35e-2 SMART
TSP1 909 968 4.95e-2 SMART
TSP1 970 1017 6.58e-5 SMART
low complexity region 1115 1129 N/A INTRINSIC
low complexity region 1158 1178 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196507
Predicted Effect probably benign
Transcript: ENSMUST00000198151
AA Change: D90G

PolyPhen 2 Score 0.150 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000142771
Gene: ENSMUSG00000043635
AA Change: D90G

DomainStartEndE-ValueType
signal peptide 1 22 N/A INTRINSIC
Pfam:Pep_M12B_propep 42 174 2.3e-29 PFAM
Meta Mutation Damage Score 0.0897 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the ADAMTS (a disintegrin and metalloproteinase with thrombospondin motifs) protein family. Members of the family share several distinct protein modules, including a propeptide region, a metalloproteinase domain, a disintegrin-like domain, and a thrombospondin type 1 (TS) motif. Individual members of this family differ in the number of C-terminal TS motifs, and some have unique C-terminal domains. The encoded preproprotein is proteolytically processed to generate the mature protease. This protease, a member of the procollagen aminopropeptidase subfamily of proteins, may play a role in the processing of type II fibrillar collagen in articular cartilage. [provided by RefSeq, Feb 2016]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,467,518 (GRCm39) C368S probably damaging Het
Astn2 T C 4: 65,832,010 (GRCm39) Y500C probably damaging Het
Atp12a A T 14: 56,612,079 (GRCm39) T418S probably benign Het
Atp6v0a2 C T 5: 124,794,981 (GRCm39) T656M possibly damaging Het
Camsap2 G A 1: 136,208,547 (GRCm39) P971S possibly damaging Het
Ccdc116 T C 16: 16,960,307 (GRCm39) H170R probably benign Het
Ccn5 G A 2: 163,674,266 (GRCm39) R222Q probably benign Het
Cemip2 A G 19: 21,795,303 (GRCm39) D732G possibly damaging Het
Clpb A G 7: 101,372,035 (GRCm39) D257G probably benign Het
Cpb2 T C 14: 75,493,473 (GRCm39) probably null Het
D430041D05Rik G A 2: 104,085,660 (GRCm39) T164I possibly damaging Het
Dhx40 T G 11: 86,680,089 (GRCm39) Q416P probably benign Het
Dnah17 A G 11: 117,984,373 (GRCm39) F1636S probably damaging Het
Fhl3 T C 4: 124,599,463 (GRCm39) S13P probably damaging Het
Gapvd1 A T 2: 34,578,875 (GRCm39) I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 (GRCm39) A61T unknown Het
Gm20939 T A 17: 95,184,721 (GRCm39) H456Q probably damaging Het
Golga4 T A 9: 118,388,411 (GRCm39) S1844R possibly damaging Het
Grm6 G C 11: 50,755,348 (GRCm39) G827R probably damaging Het
Grm7 T A 6: 111,472,866 (GRCm39) probably null Het
Hdc G A 2: 126,435,910 (GRCm39) P654S probably damaging Het
Hoxb1 T C 11: 96,257,119 (GRCm39) L156P probably benign Het
Ipo9 G T 1: 135,327,867 (GRCm39) Q515K probably benign Het
Kcnk3 T C 5: 30,779,414 (GRCm39) S155P probably damaging Het
Mboat2 T A 12: 25,004,239 (GRCm39) W347R probably damaging Het
Mib1 C T 18: 10,760,831 (GRCm39) Q374* probably null Het
Ncor2 A G 5: 125,132,855 (GRCm39) F44S probably damaging Het
Nipal3 A T 4: 135,204,776 (GRCm39) I125N probably damaging Het
Or4c113 A G 2: 88,884,843 (GRCm39) V309A probably benign Het
Or51a43 A G 7: 103,717,794 (GRCm39) V148A probably benign Het
Ovch2 A G 7: 107,389,596 (GRCm39) L317P possibly damaging Het
Pnpla2 T A 7: 141,035,380 (GRCm39) C61S probably benign Het
Ppp1r16b G T 2: 158,598,877 (GRCm39) L312F probably damaging Het
Rdm1 T A 11: 101,521,716 (GRCm39) L157H possibly damaging Het
Rpl22 C A 4: 152,412,002 (GRCm39) T26N possibly damaging Het
Rptn A G 3: 93,306,015 (GRCm39) Y1116C possibly damaging Het
Serpinb5 G A 1: 106,803,770 (GRCm39) S152N probably benign Het
Setx GTGGCT GT 2: 29,044,073 (GRCm39) 1814 probably null Het
St8sia1 A T 6: 142,774,963 (GRCm39) F205L probably damaging Het
Stab2 A G 10: 86,697,325 (GRCm39) Y1988H probably damaging Het
Susd3 A T 13: 49,401,945 (GRCm39) M1K probably null Het
Syne3 A T 12: 104,934,343 (GRCm39) L55Q probably damaging Het
Tmx1 T A 12: 70,512,895 (GRCm39) C268S probably benign Het
Ttll1 T C 15: 83,376,760 (GRCm39) K321R probably damaging Het
Zdhhc18 G T 4: 133,360,455 (GRCm39) H82Q probably benign Het
Zhx1 T C 15: 57,917,077 (GRCm39) I390V probably damaging Het
Other mutations in Adamts3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00160:Adamts3 APN 5 90,009,184 (GRCm39) missense probably damaging 1.00
IGL00340:Adamts3 APN 5 89,849,525 (GRCm39) missense probably damaging 1.00
IGL00923:Adamts3 APN 5 89,832,235 (GRCm39) missense probably benign 0.06
IGL01420:Adamts3 APN 5 89,850,916 (GRCm39) missense possibly damaging 0.57
IGL01522:Adamts3 APN 5 89,850,802 (GRCm39) missense probably benign 0.14
IGL01676:Adamts3 APN 5 90,029,402 (GRCm39) missense possibly damaging 0.54
IGL01676:Adamts3 APN 5 89,825,613 (GRCm39) missense probably benign 0.00
IGL01678:Adamts3 APN 5 89,855,715 (GRCm39) missense probably damaging 1.00
IGL01936:Adamts3 APN 5 90,009,282 (GRCm39) missense probably benign 0.00
IGL01956:Adamts3 APN 5 89,825,770 (GRCm39) missense probably damaging 0.99
IGL02342:Adamts3 APN 5 89,839,332 (GRCm39) splice site probably null
IGL02415:Adamts3 APN 5 89,854,506 (GRCm39) splice site probably null
IGL03261:Adamts3 APN 5 90,030,756 (GRCm39) utr 5 prime probably benign
IGL03301:Adamts3 APN 5 89,855,263 (GRCm39) missense probably damaging 1.00
R0041:Adamts3 UTSW 5 89,832,326 (GRCm39) missense probably benign
R0079:Adamts3 UTSW 5 89,840,912 (GRCm39) missense probably benign 0.00
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0096:Adamts3 UTSW 5 89,849,576 (GRCm39) nonsense probably null
R0477:Adamts3 UTSW 5 89,832,366 (GRCm39) missense probably benign
R0605:Adamts3 UTSW 5 90,009,334 (GRCm39) missense possibly damaging 0.96
R1036:Adamts3 UTSW 5 89,843,952 (GRCm39) splice site probably benign
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1462:Adamts3 UTSW 5 90,009,208 (GRCm39) missense probably benign 0.17
R1621:Adamts3 UTSW 5 89,869,560 (GRCm39) missense probably damaging 1.00
R1799:Adamts3 UTSW 5 89,923,280 (GRCm39) missense probably benign 0.00
R2163:Adamts3 UTSW 5 89,856,577 (GRCm39) missense probably damaging 0.99
R2412:Adamts3 UTSW 5 89,849,630 (GRCm39) missense probably damaging 0.99
R2420:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2421:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2422:Adamts3 UTSW 5 89,831,034 (GRCm39) missense probably damaging 0.97
R2921:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R2922:Adamts3 UTSW 5 90,009,393 (GRCm39) missense possibly damaging 0.90
R3402:Adamts3 UTSW 5 89,849,592 (GRCm39) missense probably benign 0.04
R3431:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3432:Adamts3 UTSW 5 89,855,312 (GRCm39) splice site probably benign
R3813:Adamts3 UTSW 5 89,825,785 (GRCm39) missense possibly damaging 0.67
R3816:Adamts3 UTSW 5 89,853,123 (GRCm39) missense probably damaging 0.99
R3905:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3906:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3907:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R3908:Adamts3 UTSW 5 90,009,214 (GRCm39) missense probably damaging 1.00
R4557:Adamts3 UTSW 5 89,848,346 (GRCm39) missense probably benign 0.03
R4684:Adamts3 UTSW 5 89,850,866 (GRCm39) missense probably damaging 0.98
R4844:Adamts3 UTSW 5 89,825,675 (GRCm39) missense probably damaging 0.99
R4925:Adamts3 UTSW 5 89,832,182 (GRCm39) missense probably benign 0.01
R5097:Adamts3 UTSW 5 89,840,909 (GRCm39) missense probably damaging 0.97
R5100:Adamts3 UTSW 5 89,856,502 (GRCm39) missense probably damaging 1.00
R5237:Adamts3 UTSW 5 89,923,236 (GRCm39) missense probably benign
R5265:Adamts3 UTSW 5 90,009,411 (GRCm39) missense possibly damaging 0.91
R5322:Adamts3 UTSW 5 89,855,159 (GRCm39) splice site probably null
R5413:Adamts3 UTSW 5 89,856,626 (GRCm39) missense probably damaging 1.00
R5459:Adamts3 UTSW 5 89,839,332 (GRCm39) splice site probably null
R5738:Adamts3 UTSW 5 89,856,527 (GRCm39) missense probably damaging 1.00
R5979:Adamts3 UTSW 5 90,009,528 (GRCm39) missense probably damaging 0.96
R5992:Adamts3 UTSW 5 89,839,194 (GRCm39) missense probably damaging 1.00
R6364:Adamts3 UTSW 5 89,869,673 (GRCm39) missense possibly damaging 0.92
R6572:Adamts3 UTSW 5 90,009,468 (GRCm39) missense possibly damaging 0.87
R7098:Adamts3 UTSW 5 90,009,354 (GRCm39) missense probably damaging 1.00
R7172:Adamts3 UTSW 5 90,030,860 (GRCm39) start gained probably benign
R7263:Adamts3 UTSW 5 89,825,601 (GRCm39) missense probably benign 0.03
R7401:Adamts3 UTSW 5 89,855,309 (GRCm39) critical splice acceptor site probably null
R7599:Adamts3 UTSW 5 90,009,256 (GRCm39) missense probably benign 0.00
R7829:Adamts3 UTSW 5 90,009,349 (GRCm39) missense probably damaging 1.00
R7835:Adamts3 UTSW 5 89,848,299 (GRCm39) missense possibly damaging 0.70
R7892:Adamts3 UTSW 5 90,009,288 (GRCm39) missense probably benign 0.10
R8021:Adamts3 UTSW 5 89,831,043 (GRCm39) missense possibly damaging 0.47
R8289:Adamts3 UTSW 5 89,923,282 (GRCm39) missense possibly damaging 0.89
R8350:Adamts3 UTSW 5 89,850,815 (GRCm39) missense probably damaging 1.00
R8468:Adamts3 UTSW 5 89,842,627 (GRCm39) missense probably benign 0.19
R8827:Adamts3 UTSW 5 89,839,324 (GRCm39) missense probably benign 0.03
R8864:Adamts3 UTSW 5 89,854,981 (GRCm39) intron probably benign
R8906:Adamts3 UTSW 5 89,825,575 (GRCm39) missense probably damaging 0.98
R9000:Adamts3 UTSW 5 89,854,570 (GRCm39) missense probably benign 0.17
R9005:Adamts3 UTSW 5 89,825,693 (GRCm39) missense probably benign 0.08
R9378:Adamts3 UTSW 5 89,848,269 (GRCm39) nonsense probably null
R9505:Adamts3 UTSW 5 89,855,751 (GRCm39) missense probably damaging 1.00
R9516:Adamts3 UTSW 5 89,834,750 (GRCm39) missense probably damaging 1.00
X0064:Adamts3 UTSW 5 89,850,901 (GRCm39) missense possibly damaging 0.75
Z1088:Adamts3 UTSW 5 89,832,308 (GRCm39) missense probably damaging 0.99
Z1176:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,923,210 (GRCm39) missense not run
Z1177:Adamts3 UTSW 5 89,855,723 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- TGTCACCAACATAGGCACAG -3'
(R):5'- TCTCCTACTGTCTGATGCGG -3'

Sequencing Primer
(F):5'- ACATAGGCACAGCTGGTCTGC -3'
(R):5'- ACTGTCTGATGCGGTACAATTC -3'
Posted On 2014-12-29