Incidental Mutation 'R2923:Pnpla2'
ID255625
Institutional Source Beutler Lab
Gene Symbol Pnpla2
Ensembl Gene ENSMUSG00000025509
Gene Namepatatin-like phospholipase domain containing 2
SynonymsAtgl, 0610039C21Rik, 1110001C14Rik, desnutrin
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.400) question?
Stock #R2923 (G1)
Quality Score168
Status Validated
Chromosome7
Chromosomal Location141455198-141460743 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 141455467 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Serine at position 61 (C61S)
Ref Sequence ENSEMBL: ENSMUSP00000127983 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026583] [ENSMUST00000064151] [ENSMUST00000084434] [ENSMUST00000106003] [ENSMUST00000106004] [ENSMUST00000164016] [ENSMUST00000164924] [ENSMUST00000165487] [ENSMUST00000169665]
Predicted Effect unknown
Transcript: ENSMUST00000026583
AA Change: C61S
SMART Domains Protein: ENSMUSP00000026583
Gene: ENSMUSG00000025509
AA Change: C61S

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000064151
AA Change: C61S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000065116
Gene: ENSMUSG00000025509
AA Change: C61S

DomainStartEndE-ValueType
Pfam:Patatin 10 179 1.8e-15 PFAM
low complexity region 409 425 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000084434
SMART Domains Protein: ENSMUSP00000081474
Gene: ENSMUSG00000025508

DomainStartEndE-ValueType
Pfam:Ribosomal_60s 17 114 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106003
SMART Domains Protein: ENSMUSP00000101625
Gene: ENSMUSG00000025508

DomainStartEndE-ValueType
Pfam:Ribosomal_60s 17 114 1e-28 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000106004
SMART Domains Protein: ENSMUSP00000101626
Gene: ENSMUSG00000025508

DomainStartEndE-ValueType
Pfam:Ribosomal_60s 17 114 2.1e-28 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134636
Predicted Effect probably benign
Transcript: ENSMUST00000164016
AA Change: C61S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127149
Gene: ENSMUSG00000025509
AA Change: C61S

DomainStartEndE-ValueType
Pfam:Patatin 10 179 3.3e-15 PFAM
low complexity region 243 287 N/A INTRINSIC
low complexity region 465 481 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000164924
AA Change: C61S
SMART Domains Protein: ENSMUSP00000129632
Gene: ENSMUSG00000025509
AA Change: C61S

DomainStartEndE-ValueType
Pfam:Patatin 10 69 4.5e-11 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000165487
Predicted Effect probably benign
Transcript: ENSMUST00000169665
AA Change: C61S

PolyPhen 2 Score 0.151 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000127983
Gene: ENSMUSG00000025509
AA Change: C61S

DomainStartEndE-ValueType
Pfam:Patatin 10 249 3.4e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000169723
Meta Mutation Damage Score 0.08 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes an enzyme which catalyzes the first step in the hydrolysis of triglycerides in adipose tissue. Mutations in this gene are associated with neutral lipid storage disease with myopathy. [provided by RefSeq, Jul 2010]
PHENOTYPE: Mice homozygous for this targeted mutation have defects in lipolysis and altered energy metabolism. Triglyceride accumulation in cardiac muscle leads to severe cardiac dysfunction and mortality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Pnpla2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02267:Pnpla2 APN 7 141458209 missense probably damaging 1.00
IGL02622:Pnpla2 APN 7 141455372 missense probably damaging 1.00
R0334:Pnpla2 UTSW 7 141459520 unclassified probably null
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1145:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1171:Pnpla2 UTSW 7 141458881 missense probably benign 0.05
R1435:Pnpla2 UTSW 7 141457411 missense probably benign 0.00
R1774:Pnpla2 UTSW 7 141459568 missense probably damaging 0.96
R1866:Pnpla2 UTSW 7 141455416 missense probably damaging 1.00
R1967:Pnpla2 UTSW 7 141459432 missense probably benign 0.21
R2153:Pnpla2 UTSW 7 141459219 missense probably damaging 1.00
R2443:Pnpla2 UTSW 7 141458069 missense possibly damaging 0.73
R2964:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R2966:Pnpla2 UTSW 7 141458478 missense probably damaging 1.00
R4576:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4577:Pnpla2 UTSW 7 141457344 missense probably damaging 1.00
R4646:Pnpla2 UTSW 7 141458661 missense possibly damaging 0.69
R4677:Pnpla2 UTSW 7 141458443 missense probably damaging 1.00
R4934:Pnpla2 UTSW 7 141458172 missense probably damaging 1.00
R5011:Pnpla2 UTSW 7 141459291 critical splice donor site probably null
R5334:Pnpla2 UTSW 7 141459493 missense probably damaging 0.97
R6331:Pnpla2 UTSW 7 141459285 missense probably damaging 0.99
R7361:Pnpla2 UTSW 7 141457431 missense possibly damaging 0.77
X0020:Pnpla2 UTSW 7 141459660 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GGAGACCAAGTGGAACATCTC -3'
(R):5'- CCAAGAGAATGCCATGAGCC -3'

Sequencing Primer
(F):5'- CAAGTGGAACATCTCATTCGCTGG -3'
(R):5'- AGCTCAGAACTGGACTTTCG -3'
Posted On2014-12-29