Incidental Mutation 'R2923:Grm6'
ID255628
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Nameglutamate receptor, metabotropic 6
Synonymsnerg1, nob2, mGluR6, nob3
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome11
Chromosomal Location50850685-50866208 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 50864521 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Arginine at position 827 (G827R)
Ref Sequence ENSEMBL: ENSMUSP00000130728 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
Predicted Effect probably damaging
Transcript: ENSMUST00000000631
AA Change: G827R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: G827R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126890
Predicted Effect probably damaging
Transcript: ENSMUST00000171427
AA Change: G827R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: G827R

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Meta Mutation Damage Score 0.406 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50863297 splice site probably benign
IGL01305:Grm6 APN 11 50859519 missense probably benign 0.27
IGL02121:Grm6 APN 11 50859656 missense probably damaging 1.00
IGL02413:Grm6 APN 11 50859939 missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50859519 missense probably benign 0.27
R0089:Grm6 UTSW 11 50859965 missense probably damaging 1.00
R0135:Grm6 UTSW 11 50853223 missense probably damaging 0.99
R0147:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50857256 missense probably damaging 1.00
R1577:Grm6 UTSW 11 50863145 missense probably damaging 1.00
R1666:Grm6 UTSW 11 50859884 missense probably damaging 1.00
R4060:Grm6 UTSW 11 50853224 missense probably damaging 1.00
R4486:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4488:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4489:Grm6 UTSW 11 50859989 missense probably damaging 0.99
R4646:Grm6 UTSW 11 50857206 missense probably benign 0.03
R4701:Grm6 UTSW 11 50863010 missense probably damaging 1.00
R4785:Grm6 UTSW 11 50857277 missense probably benign 0.00
R4860:Grm6 UTSW 11 50864612 missense probably benign 0.31
R5603:Grm6 UTSW 11 50856959 missense probably damaging 1.00
R6104:Grm6 UTSW 11 50859317 missense possibly damaging 0.89
R6746:Grm6 UTSW 11 50856963 missense probably damaging 1.00
R6791:Grm6 UTSW 11 50859774 missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50853389 missense probably benign 0.24
R6856:Grm6 UTSW 11 50859825 missense probably damaging 1.00
R7102:Grm6 UTSW 11 50862977 missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50863043 missense probably damaging 0.97
X0025:Grm6 UTSW 11 50863095 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCACCTCCAGTCTATATGTAGTG -3'
(R):5'- TCTTTGAAGCCACGAACAGC -3'

Sequencing Primer
(F):5'- ACCTCCAGTCTATATGTAGTGGAGAG -3'
(R):5'- TTTGAAGCCACGAACAGCAAAGG -3'
Posted On2014-12-29