Incidental Mutation 'R2923:Cpb2'
ID255640
Institutional Source Beutler Lab
Gene Symbol Cpb2
Ensembl Gene ENSMUSG00000021999
Gene Namecarboxypeptidase B2 (plasma)
Synonymscarboxypeptidase U, TAFI, carboxypeptidase R, CPR, CPU, 1110032P04Rik, thrombin-activatable fibrinolysis inhibitor, 4930405E17Rik
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.085) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome14
Chromosomal Location75242287-75283555 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (2 bp from exon)
DNA Base Change (assembly) T to C at 75256033 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000022576 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022576]
Predicted Effect probably null
Transcript: ENSMUST00000022576
SMART Domains Protein: ENSMUSP00000022576
Gene: ENSMUSG00000021999

DomainStartEndE-ValueType
signal peptide 1 21 N/A INTRINSIC
Pfam:Propep_M14 28 104 2.3e-17 PFAM
Zn_pept 122 406 2.1e-134 SMART
Meta Mutation Damage Score 0.526 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype FUNCTION: This gene encodes carboxypeptidase B, a zinc-dependent metalloprotease that cleaves peptide bonds at the C-terminus of protein substrates. The encoded preproprotein undergoes proteolytic activation to generate a mature, functional enzyme, and secreted into plasma. [provided by RefSeq, Jan 2016]
PHENOTYPE: Homozygous null mice exhibit altered plasma clot lysis and may show reduced bleomycin-induced lung fibrosis, impaired healing of cutaneous wounds and colonic anastomoses, altered glomerular structure, or complement-mediated lethal inflammation after LPS sensitization. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Cpb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00687:Cpb2 APN 14 75275093 missense possibly damaging 0.64
IGL00925:Cpb2 APN 14 75260750 missense possibly damaging 0.56
IGL01069:Cpb2 APN 14 75270775 missense probably damaging 1.00
IGL01521:Cpb2 APN 14 75257631 missense probably damaging 1.00
IGL02331:Cpb2 APN 14 75283404 missense possibly damaging 0.93
IGL02947:Cpb2 APN 14 75283318 missense probably damaging 1.00
IGL02961:Cpb2 APN 14 75265383 missense probably benign
PIT4677001:Cpb2 UTSW 14 75256023 missense probably benign
R0271:Cpb2 UTSW 14 75257709 splice site probably null
R0277:Cpb2 UTSW 14 75265458 missense probably damaging 1.00
R0372:Cpb2 UTSW 14 75242377 missense probably benign 0.01
R1893:Cpb2 UTSW 14 75255963 missense probably benign 0.44
R1926:Cpb2 UTSW 14 75242397 missense probably benign 0.07
R2372:Cpb2 UTSW 14 75268050 missense probably damaging 0.97
R3714:Cpb2 UTSW 14 75283217 splice site probably null
R5958:Cpb2 UTSW 14 75283387 missense probably damaging 1.00
R5987:Cpb2 UTSW 14 75260688 missense probably damaging 1.00
R6354:Cpb2 UTSW 14 75257705 critical splice donor site probably null
R6495:Cpb2 UTSW 14 75275079 missense probably damaging 1.00
R6984:Cpb2 UTSW 14 75265458 missense possibly damaging 0.78
R7211:Cpb2 UTSW 14 75274990 missense probably damaging 1.00
R7380:Cpb2 UTSW 14 75256009 missense possibly damaging 0.77
R7444:Cpb2 UTSW 14 75283342 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GTCTGCCTGTGCCCTAATACAC -3'
(R):5'- CTACCCCTTGGCTAAGAACC -3'

Sequencing Primer
(F):5'- GCCTGTGCCCTAATACACTTTAAG -3'
(R):5'- GTGCTGACATGCTTACAGCTTCAAG -3'
Posted On2014-12-29