Incidental Mutation 'R2923:Ttll1'
ID255642
Institutional Source Beutler Lab
Gene Symbol Ttll1
Ensembl Gene ENSMUSG00000022442
Gene Nametubulin tyrosine ligase-like 1
Synonyms
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.891) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome15
Chromosomal Location83483769-83510893 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83492559 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Arginine at position 321 (K321R)
Ref Sequence ENSEMBL: ENSMUSP00000105106 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000016897] [ENSMUST00000109479] [ENSMUST00000109480]
Predicted Effect probably damaging
Transcript: ENSMUST00000016897
AA Change: K321R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000016897
Gene: ENSMUSG00000022442
AA Change: K321R

DomainStartEndE-ValueType
Pfam:TTL 50 364 5.3e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109479
SMART Domains Protein: ENSMUSP00000105105
Gene: ENSMUSG00000022442

DomainStartEndE-ValueType
Pfam:TTL 49 297 1.5e-83 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000109480
AA Change: K321R

PolyPhen 2 Score 0.974 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000105106
Gene: ENSMUSG00000022442
AA Change: K321R

DomainStartEndE-ValueType
Pfam:TTL 50 364 6.6e-116 PFAM
Meta Mutation Damage Score 0.248 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit short sperm flagellum, abnormal tracheal cilia morphology and function, abnormal mucociliary clearance, and rhinosinitus with coughing or sneezing-like noises. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Ccdc116 T C 16: 17,142,443 H170R probably benign Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Ttll1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02129:Ttll1 APN 15 83484249 missense probably benign
IGL02744:Ttll1 APN 15 83489577 missense probably benign 0.00
R0639:Ttll1 UTSW 15 83502225 nonsense probably null
R1248:Ttll1 UTSW 15 83502125 missense probably benign 0.13
R1581:Ttll1 UTSW 15 83496277 missense probably damaging 0.99
R1599:Ttll1 UTSW 15 83497354 missense probably benign 0.36
R2264:Ttll1 UTSW 15 83496408 missense probably damaging 1.00
R3786:Ttll1 UTSW 15 83484218 missense probably benign 0.00
R4200:Ttll1 UTSW 15 83492577 missense probably damaging 1.00
R4364:Ttll1 UTSW 15 83499994 missense probably damaging 0.99
R4473:Ttll1 UTSW 15 83492609 missense probably damaging 0.99
R4590:Ttll1 UTSW 15 83497345 missense probably damaging 1.00
R4949:Ttll1 UTSW 15 83502173 missense probably null 1.00
R4970:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5112:Ttll1 UTSW 15 83496396 missense probably damaging 1.00
R5231:Ttll1 UTSW 15 83489466 splice site probably null
R5911:Ttll1 UTSW 15 83502281 missense probably benign 0.07
R6368:Ttll1 UTSW 15 83489617 missense probably damaging 1.00
R6636:Ttll1 UTSW 15 83499946 missense probably damaging 1.00
R6959:Ttll1 UTSW 15 83502196 nonsense probably null
Z1088:Ttll1 UTSW 15 83498189 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- GCCCTGCTGTATGGTGTATATCTTC -3'
(R):5'- GTTTGAACCTGGTTGCACAG -3'

Sequencing Primer
(F):5'- GTATATCTTCTCATTTCTAGGTCAGC -3'
(R):5'- TGTGCAAATGAGTGTATATGCACGC -3'
Posted On2014-12-29