Incidental Mutation 'R2923:Ccdc116'
ID255643
Institutional Source Beutler Lab
Gene Symbol Ccdc116
Ensembl Gene ENSMUSG00000022768
Gene Namecoiled-coil domain containing 116
Synonyms
MMRRC Submission 040508-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2923 (G1)
Quality Score225
Status Validated
Chromosome16
Chromosomal Location17139064-17147229 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 17142443 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Arginine at position 170 (H170R)
Ref Sequence ENSEMBL: ENSMUSP00000156301 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000023452] [ENSMUST00000069064] [ENSMUST00000115709] [ENSMUST00000115711] [ENSMUST00000231493] [ENSMUST00000231597] [ENSMUST00000231708] [ENSMUST00000231726] [ENSMUST00000232033] [ENSMUST00000232344] [ENSMUST00000232479] [ENSMUST00000232540]
Predicted Effect probably benign
Transcript: ENSMUST00000023452
AA Change: H170R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000023452
Gene: ENSMUSG00000022768
AA Change: H170R

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000069064
SMART Domains Protein: ENSMUSP00000069864
Gene: ENSMUSG00000041774

DomainStartEndE-ValueType
Pfam:YdjC 7 288 1.3e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115709
AA Change: H170R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111374
Gene: ENSMUSG00000022768
AA Change: H170R

DomainStartEndE-ValueType
low complexity region 116 127 N/A INTRINSIC
low complexity region 150 161 N/A INTRINSIC
low complexity region 190 206 N/A INTRINSIC
low complexity region 488 503 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115711
AA Change: H170R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000111376
Gene: ENSMUSG00000022768
AA Change: H170R

DomainStartEndE-ValueType
Pfam:DUF4702 18 411 6.3e-223 PFAM
low complexity region 488 503 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000137267
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142576
Predicted Effect noncoding transcript
Transcript: ENSMUST00000143317
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145198
Predicted Effect noncoding transcript
Transcript: ENSMUST00000145792
Predicted Effect probably benign
Transcript: ENSMUST00000231493
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231502
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231539
Predicted Effect probably benign
Transcript: ENSMUST00000231597
Predicted Effect probably benign
Transcript: ENSMUST00000231708
Predicted Effect probably benign
Transcript: ENSMUST00000231726
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231970
Predicted Effect noncoding transcript
Transcript: ENSMUST00000231975
Predicted Effect probably benign
Transcript: ENSMUST00000232033
AA Change: H170R

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
Predicted Effect probably benign
Transcript: ENSMUST00000232344
Predicted Effect probably benign
Transcript: ENSMUST00000232479
Predicted Effect probably benign
Transcript: ENSMUST00000232540
AA Change: H170R

PolyPhen 2 Score 0.024 (Sensitivity: 0.95; Specificity: 0.81)
Meta Mutation Damage Score 0.214 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.5%
  • 20x: 95.6%
Validation Efficiency 98% (46/47)
Allele List at MGI
Other mutations in this stock
Total: 46 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam4 A T 12: 81,420,744 C368S probably damaging Het
Adamts3 T C 5: 89,861,534 D90G possibly damaging Het
Astn2 T C 4: 65,913,773 Y500C probably damaging Het
Atp12a A T 14: 56,374,622 T418S probably benign Het
Atp6v0a2 C T 5: 124,717,917 T656M possibly damaging Het
Camsap2 G A 1: 136,280,809 P971S possibly damaging Het
Clpb A G 7: 101,722,828 D257G probably benign Het
Cpb2 T C 14: 75,256,033 probably null Het
D430041D05Rik G A 2: 104,255,315 T164I possibly damaging Het
Dhx40 T G 11: 86,789,263 Q416P probably benign Het
Dnah17 A G 11: 118,093,547 F1636S probably damaging Het
Fhl3 T C 4: 124,705,670 S13P probably damaging Het
Gapvd1 A T 2: 34,688,863 I1249N probably damaging Het
Gm10604 C T 4: 11,980,122 A61T unknown Het
Gm20939 T A 17: 94,877,293 H456Q probably damaging Het
Golga4 T A 9: 118,559,343 S1844R possibly damaging Het
Grm6 G C 11: 50,864,521 G827R probably damaging Het
Grm7 T A 6: 111,495,905 probably null Het
Hdc G A 2: 126,593,990 P654S probably damaging Het
Hoxb1 T C 11: 96,366,293 L156P probably benign Het
Ipo9 G T 1: 135,400,129 Q515K probably benign Het
Kcnk3 T C 5: 30,622,070 S155P probably damaging Het
Mboat2 T A 12: 24,954,240 W347R probably damaging Het
Mib1 C T 18: 10,760,831 Q374* probably null Het
Ncor2 A G 5: 125,055,791 F44S probably damaging Het
Nipal3 A T 4: 135,477,465 I125N probably damaging Het
Olfr1218 A G 2: 89,054,499 V309A probably benign Het
Olfr644 A G 7: 104,068,587 V148A probably benign Het
Ovch2 A G 7: 107,790,389 L317P possibly damaging Het
Pnpla2 T A 7: 141,455,467 C61S probably benign Het
Ppp1r16b G T 2: 158,756,957 L312F probably damaging Het
Rdm1 T A 11: 101,630,890 L157H possibly damaging Het
Rpl22 C A 4: 152,327,545 T26N possibly damaging Het
Rptn A G 3: 93,398,708 Y1116C possibly damaging Het
Serpinb5 G A 1: 106,876,040 S152N probably benign Het
Setx GTGGCT GT 2: 29,154,061 probably null Het
St8sia1 A T 6: 142,829,237 F205L probably damaging Het
Stab2 A G 10: 86,861,461 Y1988H probably damaging Het
Susd3 A T 13: 49,248,469 M1K probably null Het
Syne3 A T 12: 104,968,084 L55Q probably damaging Het
Tmem2 A G 19: 21,817,939 D732G possibly damaging Het
Tmx1 T A 12: 70,466,121 C268S probably benign Het
Ttll1 T C 15: 83,492,559 K321R probably damaging Het
Wisp2 G A 2: 163,832,346 R222Q probably benign Het
Zdhhc18 G T 4: 133,633,144 H82Q probably benign Het
Zhx1 T C 15: 58,053,681 I390V probably damaging Het
Other mutations in Ccdc116
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01082:Ccdc116 APN 16 17141992 missense probably damaging 1.00
IGL01905:Ccdc116 APN 16 17142561 missense probably damaging 0.99
IGL02751:Ccdc116 APN 16 17141972 missense probably benign 0.00
IGL03183:Ccdc116 APN 16 17142854 missense probably benign 0.07
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0009:Ccdc116 UTSW 16 17144039 missense probably damaging 1.00
R0122:Ccdc116 UTSW 16 17142734 missense probably damaging 1.00
R0219:Ccdc116 UTSW 16 17141612 missense possibly damaging 0.93
R1664:Ccdc116 UTSW 16 17142628 missense probably benign 0.02
R1718:Ccdc116 UTSW 16 17141908 missense probably benign
R2921:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R2922:Ccdc116 UTSW 16 17142443 missense probably benign 0.02
R4119:Ccdc116 UTSW 16 17142187 missense probably damaging 1.00
R4223:Ccdc116 UTSW 16 17146945 unclassified probably benign
R5000:Ccdc116 UTSW 16 17141793 missense possibly damaging 0.95
R5293:Ccdc116 UTSW 16 17141787 missense possibly damaging 0.92
R5435:Ccdc116 UTSW 16 17142762 missense probably benign 0.38
R6694:Ccdc116 UTSW 16 17142791 missense probably benign 0.44
R7215:Ccdc116 UTSW 16 17139928 missense probably damaging 1.00
R7247:Ccdc116 UTSW 16 17139691 missense possibly damaging 0.89
Z1088:Ccdc116 UTSW 16 17147171 unclassified probably benign
Predicted Primers PCR Primer
(F):5'- TCTGGGAGCAGGATTGATTCAG -3'
(R):5'- AGGTGCCAAGTAGTAGGCATC -3'

Sequencing Primer
(F):5'- AGCAGGATTGATTCAGGATTTTC -3'
(R):5'- TGCCAAGTAGTAGGCATCGATCTC -3'
Posted On2014-12-29