Incidental Mutation 'R2924:Oxr1'
ID255675
Institutional Source Beutler Lab
Gene Symbol Oxr1
Ensembl Gene ENSMUSG00000022307
Gene Nameoxidation resistance 1
SynonymsC7B, 2210416C20Rik, C7
MMRRC Submission 040509-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2924 (G1)
Quality Score225
Status Not validated
Chromosome15
Chromosomal Location41447482-41861048 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41825957 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 526 (Y526H)
Ref Sequence ENSEMBL: ENSMUSP00000155161 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022918] [ENSMUST00000090095] [ENSMUST00000090096] [ENSMUST00000110297] [ENSMUST00000166917] [ENSMUST00000170127] [ENSMUST00000179393] [ENSMUST00000230127] [ENSMUST00000230203] [ENSMUST00000230778]
Predicted Effect probably benign
Transcript: ENSMUST00000022918
AA Change: Y526H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000022918
Gene: ENSMUSG00000022307
AA Change: Y526H

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 616 778 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090095
AA Change: Y526H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087553
Gene: ENSMUSG00000022307
AA Change: Y526H

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000090096
AA Change: Y526H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000087554
Gene: ENSMUSG00000022307
AA Change: Y526H

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000110297
AA Change: Y614H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000105926
Gene: ENSMUSG00000022307
AA Change: Y614H

DomainStartEndE-ValueType
low complexity region 31 45 N/A INTRINSIC
LysM 99 142 2.48e-9 SMART
low complexity region 201 208 N/A INTRINSIC
low complexity region 628 645 N/A INTRINSIC
TLDc 704 866 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000166917
SMART Domains Protein: ENSMUSP00000130456
Gene: ENSMUSG00000022307

DomainStartEndE-ValueType
TLDc 54 216 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000170127
AA Change: Y607H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000126266
Gene: ENSMUSG00000022307
AA Change: Y607H

DomainStartEndE-ValueType
LysM 92 135 2.48e-9 SMART
low complexity region 194 201 N/A INTRINSIC
low complexity region 621 638 N/A INTRINSIC
TLDc 670 832 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179393
AA Change: Y526H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000136923
Gene: ENSMUSG00000022307
AA Change: Y526H

DomainStartEndE-ValueType
LysM 11 54 2.48e-9 SMART
low complexity region 113 120 N/A INTRINSIC
low complexity region 540 557 N/A INTRINSIC
TLDc 589 751 1.05e-80 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000230127
Predicted Effect probably benign
Transcript: ENSMUST00000230203
AA Change: Y614H

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000230778
AA Change: Y526H

PolyPhen 2 Score 0.006 (Sensitivity: 0.97; Specificity: 0.75)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.7%
  • 10x: 97.4%
  • 20x: 95.5%
Validation Efficiency
MGI Phenotype PHENOTYPE: Homozygous mutation of this gene results in progressive cerebellar neurodegeneration and ataxia, increased apoptosis in the cerebellar granule cell layer, and premature death. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 33 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Bcl9 A G 3: 97,209,753 S542P probably benign Het
Cass4 A G 2: 172,426,672 R225G possibly damaging Het
Ddx50 A T 10: 62,627,594 V440E probably damaging Het
Dmrtc2 G A 7: 24,872,516 C12Y probably damaging Het
Dock6 A T 9: 21,809,630 I1693N probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gli2 C T 1: 118,836,359 R1354H probably benign Het
Gm5478 A T 15: 101,643,794 probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il2rb T C 15: 78,491,849 M1V probably null Het
Ints6l A G X: 56,504,836 E483G probably benign Het
Kalrn C T 16: 33,989,810 D2525N possibly damaging Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mrgpra1 G A 7: 47,334,870 probably null Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr394 A G 11: 73,887,511 I287T probably damaging Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Prex2 A G 1: 11,098,487 T236A probably damaging Het
Rbbp5 G C 1: 132,492,663 probably null Het
Slc24a2 A G 4: 87,011,724 S512P probably benign Het
Srd5a1 A G 13: 69,586,715 S191P probably damaging Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tmem132e T C 11: 82,444,323 S652P probably damaging Het
Uba6 A T 5: 86,159,271 V102D probably damaging Het
Unc13a A G 8: 71,644,952 V1158A possibly damaging Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Zc3hav1 T C 6: 38,354,110 Y38C probably damaging Het
Zfp119a C A 17: 55,868,343 D51Y possibly damaging Het
Other mutations in Oxr1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00913:Oxr1 APN 15 41820143 missense possibly damaging 0.46
IGL02243:Oxr1 APN 15 41535701 utr 5 prime probably benign
IGL02711:Oxr1 APN 15 41653671 splice site probably benign
IGL02810:Oxr1 APN 15 41813583 missense probably benign 0.26
IGL02850:Oxr1 APN 15 41854933 missense probably damaging 1.00
IGL03028:Oxr1 APN 15 41817163 missense probably damaging 1.00
IGL03126:Oxr1 APN 15 41820249 missense possibly damaging 0.66
PIT4378001:Oxr1 UTSW 15 41801582 missense probably benign 0.01
R0004:Oxr1 UTSW 15 41820540 missense possibly damaging 0.64
R0276:Oxr1 UTSW 15 41820062 missense probably damaging 1.00
R0394:Oxr1 UTSW 15 41817197 missense probably damaging 1.00
R1513:Oxr1 UTSW 15 41797474 missense probably damaging 1.00
R1742:Oxr1 UTSW 15 41850559 missense probably damaging 1.00
R2145:Oxr1 UTSW 15 41819944 missense probably damaging 1.00
R3732:Oxr1 UTSW 15 41848701 missense probably damaging 1.00
R4537:Oxr1 UTSW 15 41820519 missense possibly damaging 0.67
R4722:Oxr1 UTSW 15 41813649 missense probably damaging 1.00
R4935:Oxr1 UTSW 15 41813584 missense probably benign 0.00
R5417:Oxr1 UTSW 15 41820371 missense probably benign 0.00
R6029:Oxr1 UTSW 15 41825901 missense probably damaging 1.00
R6187:Oxr1 UTSW 15 41825919 missense probably damaging 1.00
R6864:Oxr1 UTSW 15 41823387 missense probably damaging 1.00
R6950:Oxr1 UTSW 15 41820555 missense probably benign 0.00
R7225:Oxr1 UTSW 15 41813608 missense not run
R7288:Oxr1 UTSW 15 41813608 missense not run
R7305:Oxr1 UTSW 15 41813608 missense not run
X0025:Oxr1 UTSW 15 41820452 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GGACTTGACAAATCATAGCCAAATC -3'
(R):5'- TGGCATACCATAGGTTACACACTC -3'

Sequencing Primer
(F):5'- TGTGGTATATTTTGAAAGTCTTCAGC -3'
(R):5'- CATAGGTTACACACTCACACAAAG -3'
Posted On2014-12-29