Incidental Mutation 'R2925:Ap4b1'
ID255695
Institutional Source Beutler Lab
Gene Symbol Ap4b1
Ensembl Gene ENSMUSG00000032952
Gene Nameadaptor-related protein complex AP-4, beta 1
SynonymsAP-4 beta-4, 1810038H16Rik
MMRRC Submission 040510-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.359) question?
Stock #R2925 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location103809520-103822025 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 103820681 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 337 (E337G)
Ref Sequence ENSEMBL: ENSMUSP00000143355 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000047285] [ENSMUST00000076599] [ENSMUST00000106823] [ENSMUST00000106824] [ENSMUST00000199710] [ENSMUST00000200377]
Predicted Effect probably damaging
Transcript: ENSMUST00000047285
AA Change: E505G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000044262
Gene: ENSMUSG00000032952
AA Change: E505G

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 7e-94 PFAM
Pfam:Cnd1 98 269 2.4e-11 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000076599
AA Change: E505G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000075904
Gene: ENSMUSG00000032952
AA Change: E505G

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 525 1e-93 PFAM
Pfam:Cnd1 98 286 3.9e-10 PFAM
B2-adapt-app_C 619 731 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106823
AA Change: E477G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102436
Gene: ENSMUSG00000032952
AA Change: E477G

DomainStartEndE-ValueType
Pfam:Adaptin_N 6 374 2e-68 PFAM
Pfam:Cnd1 98 285 1.4e-10 PFAM
Pfam:Adaptin_N 371 497 5.2e-16 PFAM
B2-adapt-app_C 591 703 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000106824
AA Change: E430G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000102437
Gene: ENSMUSG00000032952
AA Change: E430G

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000199686
Predicted Effect probably damaging
Transcript: ENSMUST00000199710
AA Change: E430G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000143463
Gene: ENSMUSG00000105053
AA Change: E430G

DomainStartEndE-ValueType
Pfam:Cnd1 35 212 5e-9 PFAM
Pfam:Adaptin_N 35 450 1.2e-62 PFAM
B2-adapt-app_C 544 656 3.75e-42 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000200377
AA Change: E337G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000143355
Gene: ENSMUSG00000032952
AA Change: E337G

DomainStartEndE-ValueType
Pfam:Adaptin_N 7 357 2.9e-45 PFAM
B2-adapt-app_C 451 563 2.8e-46 SMART
Meta Mutation Damage Score 0.322 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.2%
Validation Efficiency 95% (40/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of a heterotetrameric adapter-like complex 4 that is involved in targeting proteins from the trans-Golgi network to the endosomal-lysosomal system. Mutations in this gene are associated with cerebral palsy spastic quadriplegic type 5 (CPSQ5) disorder. Alternatively spliced transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2011]
PHENOTYPE: Mice homozygous for a null allele exhibit poor rotarod performance. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 41 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930503E14Rik T C 14: 44,170,298 T93A probably damaging Het
4932438A13Rik G T 3: 37,007,122 A3327S probably damaging Het
9530003J23Rik C T 10: 117,234,431 R147Q probably benign Het
AI314180 T A 4: 58,833,928 K851* probably null Het
Akr1c21 A G 13: 4,576,350 probably null Het
Alk A G 17: 72,603,207 V168A probably benign Het
Btn2a2 A G 13: 23,481,814 S283P probably damaging Het
Ctcfl C T 2: 173,094,696 E628K probably damaging Het
Cul9 G A 17: 46,510,981 T1856M probably benign Het
Defb41 T C 1: 18,260,633 D30G probably damaging Het
Dnaic1 A T 4: 41,597,919 I74F probably damaging Het
Fbln2 T A 6: 91,265,855 C846S probably damaging Het
Fuom T C 7: 140,099,949 T110A probably benign Het
Gm498 A T 7: 143,883,999 R147* probably null Het
Hsp90aa1 T A 12: 110,695,680 M1L possibly damaging Het
Hsp90aa1 C A 12: 110,695,681 probably null Het
Il12a TCAC TC 3: 68,697,987 probably null Het
Kcnd3 C T 3: 105,658,766 A421V probably damaging Het
Man2b2 A G 5: 36,824,102 F224L probably benign Het
Mtbp G A 15: 55,619,814 R429Q probably benign Het
Ncapg2 C A 12: 116,438,729 T727K probably benign Het
Nek4 G A 14: 30,951,710 G29S probably benign Het
Nsf C T 11: 103,930,752 E26K possibly damaging Het
Nup214 A G 2: 31,998,003 K15E probably damaging Het
Olfr1029 T A 2: 85,975,781 C179* probably null Het
Olfr1079 C T 2: 86,538,547 D121N probably damaging Het
Olfr206 A T 16: 59,345,343 Y119* probably null Het
Olfr460 T A 6: 40,571,408 S7R probably benign Het
P2ry13 G A 3: 59,209,380 H326Y probably benign Het
Plec A G 15: 76,178,252 F2563S probably damaging Het
Rc3h1 A G 1: 160,954,976 Y675C probably damaging Het
Samd3 T A 10: 26,251,887 S288T probably benign Het
Scaf4 G T 16: 90,250,289 P400Q unknown Het
Selplg T C 5: 113,820,179 D22G possibly damaging Het
Slc30a6 T C 17: 74,402,004 probably benign Het
Syt3 T A 7: 44,395,798 V518E probably damaging Het
Tnks G A 8: 34,965,661 A2V unknown Het
Upk3a A G 15: 85,018,149 Y59C probably benign Het
Usp4 T C 9: 108,367,856 L331P probably damaging Het
Zbed5 A G 5: 129,903,198 T663A possibly damaging Het
Zbtb11 G A 16: 55,974,084 R8Q probably benign Het
Other mutations in Ap4b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00391:Ap4b1 APN 3 103821542 missense probably benign 0.19
IGL01545:Ap4b1 APN 3 103812827 missense probably benign 0.02
IGL02422:Ap4b1 APN 3 103812854 missense possibly damaging 0.95
IGL02525:Ap4b1 APN 3 103812848 missense probably damaging 1.00
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0035:Ap4b1 UTSW 3 103820664 splice site probably benign
R0086:Ap4b1 UTSW 3 103814860 missense probably damaging 0.99
R0090:Ap4b1 UTSW 3 103820429 missense possibly damaging 0.91
R0136:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0299:Ap4b1 UTSW 3 103809946 start codon destroyed probably null 1.00
R0403:Ap4b1 UTSW 3 103818839 missense probably damaging 0.99
R0403:Ap4b1 UTSW 3 103821396 missense probably benign 0.00
R1283:Ap4b1 UTSW 3 103818861 missense probably damaging 1.00
R1673:Ap4b1 UTSW 3 103817845 critical splice donor site probably null
R1797:Ap4b1 UTSW 3 103818833 missense possibly damaging 0.92
R1869:Ap4b1 UTSW 3 103820868 nonsense probably null
R3905:Ap4b1 UTSW 3 103818893 missense possibly damaging 0.94
R4079:Ap4b1 UTSW 3 103813378 missense probably damaging 1.00
R4645:Ap4b1 UTSW 3 103821449 missense probably benign 0.32
R4786:Ap4b1 UTSW 3 103818804 missense probably benign 0.00
R5824:Ap4b1 UTSW 3 103813385 missense probably benign 0.30
R6342:Ap4b1 UTSW 3 103813368 missense possibly damaging 0.60
R6826:Ap4b1 UTSW 3 103812908 critical splice donor site probably null
R6923:Ap4b1 UTSW 3 103812214 missense probably benign 0.19
R6974:Ap4b1 UTSW 3 103813285 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CATGCTGACGTTCTCACAGC -3'
(R):5'- ATTTAGAGATAGTTGCCCAGTGG -3'

Sequencing Primer
(F):5'- ACAGCTTTCTTCGTTTGCTAAG -3'
(R):5'- CTGGCGCCAGTGTGTTGAAG -3'
Posted On2014-12-29