Incidental Mutation 'R2926:Ttll7'
ID255743
Institutional Source Beutler Lab
Gene Symbol Ttll7
Ensembl Gene ENSMUSG00000036745
Gene Nametubulin tyrosine ligase-like family, member 7
Synonyms1110049N09Rik, 4921517B04Rik
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome3
Chromosomal Location146852367-146984009 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 146930415 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Stop codon at position 438 (R438*)
Ref Sequence ENSEMBL: ENSMUSP00000129369 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037942] [ENSMUST00000106134] [ENSMUST00000170055]
Predicted Effect probably null
Transcript: ENSMUST00000037942
AA Change: R438*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000038090
SMART Domains Protein: ENSMUSP00000037875
Gene: ENSMUSG00000036745

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
low complexity region 591 601 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000106134
AA Change: R438*
SMART Domains Protein: ENSMUSP00000101740
Gene: ENSMUSG00000036745
AA Change: R438*

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 7.2e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000170055
AA Change: R438*
SMART Domains Protein: ENSMUSP00000129369
Gene: ENSMUSG00000036745
AA Change: R438*

DomainStartEndE-ValueType
low complexity region 29 38 N/A INTRINSIC
Pfam:TTL 84 388 5.9e-80 PFAM
low complexity region 417 439 N/A INTRINSIC
low complexity region 501 516 N/A INTRINSIC
low complexity region 549 563 N/A INTRINSIC
Meta Mutation Damage Score 0.576 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Ttll7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01060:Ttll7 APN 3 146909582 missense possibly damaging 0.72
IGL01353:Ttll7 APN 3 146961719 missense probably damaging 1.00
IGL01415:Ttll7 APN 3 146909599 missense possibly damaging 0.90
IGL01843:Ttll7 APN 3 146940021 missense possibly damaging 0.93
IGL03101:Ttll7 APN 3 146896690 missense possibly damaging 0.82
IGL03378:Ttll7 APN 3 146909653 missense probably benign 0.06
P0038:Ttll7 UTSW 3 146945184 missense possibly damaging 0.80
R0265:Ttll7 UTSW 3 146944160 nonsense probably null
R0358:Ttll7 UTSW 3 146944116 missense probably benign
R0363:Ttll7 UTSW 3 146944215 missense probably benign 0.00
R0364:Ttll7 UTSW 3 146945181 missense possibly damaging 0.82
R0751:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1184:Ttll7 UTSW 3 146939991 missense probably damaging 1.00
R1533:Ttll7 UTSW 3 146896667 missense probably damaging 1.00
R1771:Ttll7 UTSW 3 146894405 missense probably benign 0.02
R1789:Ttll7 UTSW 3 146915780 missense probably damaging 1.00
R1961:Ttll7 UTSW 3 146915795 splice site probably benign
R1995:Ttll7 UTSW 3 146961755 missense possibly damaging 0.95
R2083:Ttll7 UTSW 3 146930104 missense possibly damaging 0.77
R2152:Ttll7 UTSW 3 146930189 missense probably damaging 1.00
R2655:Ttll7 UTSW 3 146947621 missense probably damaging 1.00
R4888:Ttll7 UTSW 3 146894177 start codon destroyed probably null 0.99
R4999:Ttll7 UTSW 3 146894469 missense probably damaging 1.00
R5648:Ttll7 UTSW 3 146961710 missense probably damaging 1.00
R5937:Ttll7 UTSW 3 146944092 nonsense probably null
R6009:Ttll7 UTSW 3 146934535 missense probably damaging 0.99
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6036:Ttll7 UTSW 3 146940162 missense probably benign
R6463:Ttll7 UTSW 3 146931582 missense possibly damaging 0.86
R6747:Ttll7 UTSW 3 146944056 missense probably benign 0.02
R6922:Ttll7 UTSW 3 146909614 missense possibly damaging 0.92
R7123:Ttll7 UTSW 3 146913296 missense possibly damaging 0.95
X0024:Ttll7 UTSW 3 146909553 missense probably damaging 1.00
X0026:Ttll7 UTSW 3 146961695 missense probably damaging 1.00
X0027:Ttll7 UTSW 3 146947653 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGGCTGTACGGTCAAAACCC -3'
(R):5'- TGCAGACACCCGTACATGTC -3'

Sequencing Primer
(F):5'- CCCAGTAAGAAGGCTTTCGC -3'
(R):5'- CCGTACATGTCCTGAAACATAGTGAG -3'
Posted On2014-12-29