Incidental Mutation 'R2926:Adgrb2'
ID255748
Institutional Source Beutler Lab
Gene Symbol Adgrb2
Ensembl Gene ENSMUSG00000028782
Gene Nameadhesion G protein-coupled receptor B2
SynonymsBai2
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome4
Chromosomal Location129984870-130022633 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 130008344 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 506 (L506P)
Ref Sequence ENSEMBL: ENSMUSP00000112524 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030571] [ENSMUST00000097868] [ENSMUST00000106015] [ENSMUST00000106017] [ENSMUST00000106018] [ENSMUST00000120204] [ENSMUST00000121049]
Predicted Effect probably damaging
Transcript: ENSMUST00000030571
AA Change: L561P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000030571
Gene: ENSMUSG00000028782
AA Change: L561P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:GAIN 600 842 1.6e-41 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 1.7e-67 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000097868
AA Change: L561P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000095480
Gene: ENSMUSG00000028782
AA Change: L561P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 1.2e-54 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1159 2.6e-69 PFAM
low complexity region 1324 1338 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000106012
Predicted Effect probably damaging
Transcript: ENSMUST00000106015
AA Change: L561P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101636
Gene: ENSMUSG00000028782
AA Change: L561P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.4e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1192 4.1e-68 PFAM
low complexity region 1357 1371 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106017
AA Change: L561P

PolyPhen 2 Score 0.991 (Sensitivity: 0.71; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000101638
Gene: ENSMUSG00000028782
AA Change: L561P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 1.86e-13 SMART
TSP1 413 463 9.89e-9 SMART
TSP1 469 519 3.09e-10 SMART
HormR 521 587 3.27e-18 SMART
Pfam:DUF3497 597 859 6.3e-55 PFAM
GPS 864 917 2.57e-19 SMART
Pfam:7tm_2 923 1180 4.6e-68 PFAM
low complexity region 1345 1359 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106018
AA Change: L506P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000101639
Gene: ENSMUSG00000028782
AA Change: L506P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 1.1e-54 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 2.4e-69 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000120204
AA Change: L506P

PolyPhen 2 Score 0.996 (Sensitivity: 0.55; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000112524
Gene: ENSMUSG00000028782
AA Change: L506P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 9.52e-11 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 8.2e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1104 9.6e-70 PFAM
low complexity region 1269 1283 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000121049
AA Change: L506P

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000112869
Gene: ENSMUSG00000028782
AA Change: L506P

DomainStartEndE-ValueType
signal peptide 1 20 N/A INTRINSIC
low complexity region 117 127 N/A INTRINSIC
low complexity region 160 173 N/A INTRINSIC
low complexity region 197 208 N/A INTRINSIC
low complexity region 272 278 N/A INTRINSIC
TSP1 303 353 1.86e-13 SMART
TSP1 358 408 9.89e-9 SMART
TSP1 414 464 3.09e-10 SMART
HormR 466 532 3.27e-18 SMART
Pfam:DUF3497 542 804 6.1e-55 PFAM
GPS 809 862 2.57e-19 SMART
Pfam:7tm_2 868 1137 3.8e-68 PFAM
low complexity region 1302 1316 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149282
Predicted Effect noncoding transcript
Transcript: ENSMUST00000166118
Meta Mutation Damage Score 0.086 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a a seven-span transmembrane protein that is thought to be a member of the secretin receptor family. The encoded protein is a brain-specific inhibitor of angiogenesis. The mature peptide may be further cleaved into additional products (PMID:20367554). Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jun 2014]
PHENOTYPE: Mice homozygous for disruptions in this gene show a lessening of depression like behavior. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Adgrb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00309:Adgrb2 APN 4 130018805 missense probably damaging 1.00
IGL00425:Adgrb2 APN 4 130019072 missense probably benign 0.09
IGL00490:Adgrb2 APN 4 130011872 missense possibly damaging 0.82
IGL00928:Adgrb2 APN 4 129992303 missense probably benign
IGL01353:Adgrb2 APN 4 130012300 missense probably damaging 1.00
IGL01521:Adgrb2 APN 4 129992292 missense probably damaging 0.98
IGL01590:Adgrb2 APN 4 130013813 splice site probably benign
IGL01813:Adgrb2 APN 4 130012566 missense probably benign 0.00
IGL01831:Adgrb2 APN 4 130009394 missense probably damaging 1.00
IGL01939:Adgrb2 APN 4 129992132 missense probably damaging 0.99
IGL01960:Adgrb2 APN 4 130012384 splice site probably benign
IGL01993:Adgrb2 APN 4 130018842 missense possibly damaging 0.94
IGL02646:Adgrb2 APN 4 130019282 critical splice donor site probably null
IGL02655:Adgrb2 APN 4 129992179 nonsense probably null
IGL02695:Adgrb2 APN 4 130018832 missense probably damaging 1.00
IGL02998:Adgrb2 APN 4 130019069 missense probably benign 0.15
IGL03372:Adgrb2 APN 4 130017569 missense probably benign 0.42
R0098:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0206:Adgrb2 UTSW 4 129992559 missense probably damaging 1.00
R0311:Adgrb2 UTSW 4 130017129 missense probably damaging 1.00
R0380:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0382:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0492:Adgrb2 UTSW 4 130007831 missense probably damaging 0.99
R0544:Adgrb2 UTSW 4 130017542 missense probably damaging 0.98
R0965:Adgrb2 UTSW 4 129992416 small deletion probably benign
R1458:Adgrb2 UTSW 4 130014591 missense possibly damaging 0.48
R1601:Adgrb2 UTSW 4 129992837 missense probably benign 0.43
R1711:Adgrb2 UTSW 4 129992624 missense probably damaging 1.00
R1758:Adgrb2 UTSW 4 130011875 missense probably damaging 1.00
R1783:Adgrb2 UTSW 4 130009305 missense possibly damaging 0.61
R1827:Adgrb2 UTSW 4 130012557 missense probably damaging 1.00
R1838:Adgrb2 UTSW 4 130010231 missense probably benign 0.00
R1881:Adgrb2 UTSW 4 130010285 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1888:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R1894:Adgrb2 UTSW 4 130013626 missense probably damaging 1.00
R2275:Adgrb2 UTSW 4 130006854 missense probably damaging 1.00
R4472:Adgrb2 UTSW 4 130008353 missense probably benign 0.12
R4490:Adgrb2 UTSW 4 130012328 missense possibly damaging 0.91
R4499:Adgrb2 UTSW 4 129992661 missense probably damaging 0.99
R4758:Adgrb2 UTSW 4 130009350 missense probably damaging 1.00
R4900:Adgrb2 UTSW 4 130013875 missense probably damaging 1.00
R4904:Adgrb2 UTSW 4 130012539 missense possibly damaging 0.50
R4922:Adgrb2 UTSW 4 130007852 missense probably damaging 1.00
R5330:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5331:Adgrb2 UTSW 4 130022202 missense possibly damaging 0.92
R5550:Adgrb2 UTSW 4 130014934 critical splice acceptor site probably null
R5995:Adgrb2 UTSW 4 130017103 missense probably damaging 1.00
R6047:Adgrb2 UTSW 4 130018705 missense probably damaging 1.00
R6534:Adgrb2 UTSW 4 130022219 missense probably damaging 0.98
R6565:Adgrb2 UTSW 4 130019276 missense probably damaging 1.00
R6813:Adgrb2 UTSW 4 130009491 missense probably damaging 1.00
R6963:Adgrb2 UTSW 4 130014362 frame shift probably null
R6966:Adgrb2 UTSW 4 130014362 frame shift probably null
Predicted Primers PCR Primer
(F):5'- GCAGCTGGCGAGATCATTTAC -3'
(R):5'- TTTATACCAAGGCATGAGGGAATG -3'

Sequencing Primer
(F):5'- GGCGAGATCATTTACAACAAGTGTCC -3'
(R):5'- CATGAGGGAATGAATGAGCCTTAAGC -3'
Posted On2014-12-29