Incidental Mutation 'R2926:Kl'
ID255754
Institutional Source Beutler Lab
Gene Symbol Kl
Ensembl Gene ENSMUSG00000058488
Gene Nameklotho
Synonymsalpha-kl
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome5
Chromosomal Location150952607-150993817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 150953341 bp
ZygosityHeterozygous
Amino Acid Change Tryptophan to Arginine at position 209 (W209R)
Ref Sequence ENSEMBL: ENSMUSP00000077899 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078856]
Predicted Effect probably damaging
Transcript: ENSMUST00000078856
AA Change: W209R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077899
Gene: ENSMUSG00000058488
AA Change: W209R

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
low complexity region 45 56 N/A INTRINSIC
Pfam:Glyco_hydro_1 59 380 4.3e-99 PFAM
Pfam:Glyco_hydro_1 376 508 7.9e-33 PFAM
Pfam:Glyco_hydro_1 517 955 1e-79 PFAM
transmembrane domain 984 1006 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000202096
Meta Mutation Damage Score 0.672 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a type-I membrane protein that is related to beta-glucosidases. Reduced production of this protein has been observed in patients with chronic renal failure (CRF), and this may be one of the factors underlying the degenerative processes (e.g., arteriosclerosis, osteoporosis, and skin atrophy) seen in CRF. Also, mutations within this protein have been associated with ageing and bone loss. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mutant mice have a short lifespan and growth retardation with one allele homeostatic imbalances and soft tissue calcification are also seen. With a second allele abnormal cancellous bone and femur morphology are seen. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
Colec11 T A 12: 28,617,429 Q37L probably damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Kl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00800:Kl APN 5 150980768 nonsense probably null
IGL00815:Kl APN 5 150980850 missense possibly damaging 0.55
IGL00840:Kl APN 5 150980787 missense possibly damaging 0.90
IGL01347:Kl APN 5 150980665 missense probably damaging 1.00
IGL01642:Kl APN 5 150980869 missense possibly damaging 0.58
IGL01774:Kl APN 5 150988483 missense probably benign 0.00
IGL01937:Kl APN 5 150988937 missense probably damaging 0.99
IGL01945:Kl APN 5 150988937 missense probably damaging 0.99
IGL02510:Kl APN 5 150989001 missense probably damaging 1.00
IGL02696:Kl APN 5 150980985 missense probably benign 0.01
IGL03028:Kl APN 5 150991550 missense probably damaging 1.00
IGL03149:Kl APN 5 150982735 nonsense probably null
anatolia UTSW 5 150988853 missense possibly damaging 0.69
ararat UTSW 5 150988853 missense possibly damaging 0.69
R0480:Kl UTSW 5 150953288 missense probably damaging 1.00
R0565:Kl UTSW 5 150980944 missense possibly damaging 0.76
R0723:Kl UTSW 5 150953101 missense probably damaging 1.00
R1052:Kl UTSW 5 150982520 missense probably damaging 1.00
R1205:Kl UTSW 5 150980688 missense probably damaging 1.00
R1512:Kl UTSW 5 150988597 missense probably benign 0.00
R1529:Kl UTSW 5 150988941 missense probably benign
R1588:Kl UTSW 5 150982632 missense probably benign 0.20
R1714:Kl UTSW 5 150953333 missense probably benign 0.05
R1748:Kl UTSW 5 150980985 missense possibly damaging 0.87
R1885:Kl UTSW 5 150953494 missense possibly damaging 0.67
R1920:Kl UTSW 5 150982667 missense probably benign 0.15
R2156:Kl UTSW 5 150988960 missense probably benign 0.41
R4837:Kl UTSW 5 150980847 missense possibly damaging 0.90
R5221:Kl UTSW 5 150989151 missense probably damaging 1.00
R5687:Kl UTSW 5 150988466 missense possibly damaging 0.84
R5726:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5727:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5735:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5797:Kl UTSW 5 150991538 missense possibly damaging 0.91
R5933:Kl UTSW 5 150989483 missense probably damaging 1.00
R6075:Kl UTSW 5 150953001 missense probably damaging 1.00
R6076:Kl UTSW 5 150953001 missense probably damaging 1.00
R6077:Kl UTSW 5 150953001 missense probably damaging 1.00
R6149:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6150:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6151:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6158:Kl UTSW 5 150988853 missense possibly damaging 0.69
R6236:Kl UTSW 5 150953290 missense probably damaging 1.00
R6609:Kl UTSW 5 150988962 missense probably benign 0.00
X0066:Kl UTSW 5 150991615 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTTACAACAACGTCTACCGC -3'
(R):5'- TCACCAAAAGTAGGTTGTGGG -3'

Sequencing Primer
(F):5'- TCTACCGCGACACAGAGG -3'
(R):5'- AACCAGGTACCCGAGCCTG -3'
Posted On2014-12-29