Incidental Mutation 'R2926:Colec11'
ID255774
Institutional Source Beutler Lab
Gene Symbol Colec11
Ensembl Gene ENSMUSG00000036655
Gene Namecollectin sub-family member 11
Synonyms
MMRRC Submission 040511-MU
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R2926 (G1)
Quality Score225
Status Validated
Chromosome12
Chromosomal Location28594173-28623377 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 28617429 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Leucine at position 37 (Q37L)
Ref Sequence ENSEMBL: ENSMUSP00000152207 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036136] [ENSMUST00000220655] [ENSMUST00000220836]
Predicted Effect probably benign
Transcript: ENSMUST00000036136
AA Change: Q37L

PolyPhen 2 Score 0.320 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000049285
Gene: ENSMUSG00000036655
AA Change: Q37L

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:Collagen 40 88 5.8e-10 PFAM
Pfam:Collagen 60 116 4.7e-11 PFAM
CLECT 139 266 1.74e-19 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000220655
AA Change: Q37L

PolyPhen 2 Score 0.986 (Sensitivity: 0.74; Specificity: 0.96)
Predicted Effect probably damaging
Transcript: ENSMUST00000220836
AA Change: Q37L

PolyPhen 2 Score 0.965 (Sensitivity: 0.78; Specificity: 0.95)
Meta Mutation Damage Score 0.188 question?
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.1%
  • 20x: 94.3%
Validation Efficiency 98% (50/51)
MGI Phenotype FUNCTION: This gene encodes a member of the collectin family of C-type lectins that possess collagen-like sequences and carbohydrate recognition domains. Collectins are secreted proteins that play important roles in the innate immune system by binding to carbohydrate antigens on microorganisms, facilitating their recognition and removal. The encoded protein binds to multiple sugars with a preference for fucose and mannose. Mutations in the human gene are a cause of 3MC syndrome-2. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knockout allele exhibit decreased susceptibility to kidney reperfusion injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 49 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abcb9 G T 5: 124,078,839 S438R possibly damaging Het
Add3 A G 19: 53,226,822 probably null Het
Adgrb2 T C 4: 130,008,344 L506P probably damaging Het
Atp6v0a1 A T 11: 101,043,948 I621L probably damaging Het
AV320801 G T X: 135,499,548 A96S possibly damaging Het
Calb1 T G 4: 15,904,302 L218R probably damaging Het
Ccdc162 G A 10: 41,561,207 probably benign Het
Ccser2 A T 14: 36,879,561 S842T possibly damaging Het
Cd300a A G 11: 114,893,313 E49G possibly damaging Het
D630045J12Rik T A 6: 38,168,171 I1307F probably damaging Het
Dapk1 T C 13: 60,719,750 V257A possibly damaging Het
Dnah3 T A 7: 119,951,115 N3327I probably damaging Het
Gja8 C T 3: 96,919,153 V398I probably benign Het
Gm4450 A G 3: 98,450,556 probably benign Het
Hfm1 A T 5: 106,874,282 L179* probably null Het
Ift88 T C 14: 57,488,918 Y678H probably damaging Het
Itga10 A G 3: 96,652,849 N560D probably damaging Het
Itpk1 G T 12: 102,579,130 P238Q probably damaging Het
Kl T C 5: 150,953,341 W209R probably damaging Het
Lama4 A G 10: 39,078,832 N1127S probably benign Het
Lrp1 C T 10: 127,588,113 C830Y probably damaging Het
Mcmbp G A 7: 128,698,014 probably benign Het
Mrps33 A G 6: 39,805,504 S28P probably damaging Het
Myo9b G A 8: 71,334,337 R721Q probably benign Het
Myt1 C T 2: 181,826,010 T1079M possibly damaging Het
N4bp1 A T 8: 86,861,796 Y171* probably null Het
Ncln G T 10: 81,488,438 T442K probably benign Het
Nphp4 T C 4: 152,518,139 V390A probably damaging Het
Ntrk2 C A 13: 59,060,284 T648K probably damaging Het
Nwd1 A G 8: 72,667,012 H301R probably damaging Het
Olfr729 A T 14: 50,148,436 V146E probably benign Het
Pcdh12 T C 18: 38,282,390 N561D probably damaging Het
Pcnx T A 12: 81,994,995 S2134T probably damaging Het
Ppp1cc G A 5: 122,174,088 A306T probably benign Het
Prrc2c C T 1: 162,706,127 probably benign Het
Rabggta C T 14: 55,719,290 R319H probably benign Het
Scn10a A C 9: 119,638,701 F791C possibly damaging Het
Stab1 T A 14: 31,161,799 D267V probably damaging Het
Sva A T 6: 42,042,662 Y152F possibly damaging Het
Tgfbrap1 T G 1: 43,075,629 M104L probably damaging Het
Tmed4 T C 11: 6,271,728 T203A probably benign Het
Toe1 C T 4: 116,804,980 A331T possibly damaging Het
Trappc9 G A 15: 73,025,967 R377W probably damaging Het
Trpm7 T C 2: 126,858,409 probably benign Het
Ttll7 C T 3: 146,930,415 R438* probably null Het
Usp11 G T X: 20,717,792 G601W probably damaging Het
Vmn2r112 A G 17: 22,615,003 T551A possibly damaging Het
Vmn2r73 T C 7: 85,871,663 K366E probably benign Het
Vps33a A G 5: 123,569,571 I111T possibly damaging Het
Other mutations in Colec11
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01678:Colec11 APN 12 28594868 missense probably damaging 1.00
IGL01990:Colec11 APN 12 28594986 missense probably benign 0.30
R0759:Colec11 UTSW 12 28594731 missense probably damaging 1.00
R1796:Colec11 UTSW 12 28594859 missense probably damaging 1.00
R2086:Colec11 UTSW 12 28594787 missense probably damaging 0.99
R3624:Colec11 UTSW 12 28594908 missense probably benign 0.00
R4078:Colec11 UTSW 12 28595247 missense possibly damaging 0.75
R5680:Colec11 UTSW 12 28594731 missense probably damaging 1.00
R6768:Colec11 UTSW 12 28595101 intron probably null
Predicted Primers PCR Primer
(F):5'- ACAGTTTCTTGGCTGGAAAGAG -3'
(R):5'- TCTGATCAGAGCCTGTCACTG -3'

Sequencing Primer
(F):5'- AATGTCATGGAACCTTGGTCTCCTAG -3'
(R):5'- ATCAGAGCCTGTCACTGTTTATG -3'
Posted On2014-12-29