Incidental Mutation 'R2927:Krt16'
ID255806
Institutional Source Beutler Lab
Gene Symbol Krt16
Ensembl Gene ENSMUSG00000053797
Gene Namekeratin 16
SynonymsKrt1-16, K16
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.089) question?
Stock #R2927 (G1)
Quality Score225
Status Not validated
Chromosome11
Chromosomal Location100246091-100248902 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 100248799 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 31 (L31P)
Ref Sequence ENSEMBL: ENSMUSP00000007280 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007280]
Predicted Effect unknown
Transcript: ENSMUST00000007280
AA Change: L31P
SMART Domains Protein: ENSMUSP00000007280
Gene: ENSMUSG00000053797
AA Change: L31P

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
Filament 112 423 8.41e-170 SMART
low complexity region 454 467 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the keratin gene family. The keratins are intermediate filament proteins responsible for the structural integrity of epithelial cells and are subdivided into cytokeratins and hair keratins. The encoded protein is a cytokeratin and acts as an innate immune system effector, promoting the inflammatory response upon breach of the skin barrier. Defects in this gene are a cause of pachyonychia congenita. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit partial neonatal and postnatal lethality, decreased body weight, abnormal tongue epithelium and hyperkertotic calluses in areas of physical pressure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 20 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd109 CATTTATTTATTTATTTATTTATTTATTTATTTAT CATTTATTTATTTATTTATTTATTTATTTATTTATTTAT 9: 78,712,500 probably benign Het
Dsc2 T C 18: 20,045,501 Y282C probably damaging Het
Dsg1b C A 18: 20,405,251 P638Q probably benign Het
Eea1 C T 10: 96,013,358 S486L probably benign Het
Hspg2 C T 4: 137,518,940 R1010C probably damaging Het
Ift22 A G 5: 136,912,945 D147G probably damaging Het
Igsf10 T A 3: 59,329,427 Q1111L probably benign Het
Ikzf1 T C 11: 11,769,324 Y344H probably damaging Het
Kif1c T A 11: 70,726,314 C813S probably benign Het
Lrrc49 G A 9: 60,593,746 R633* probably null Het
Mllt6 T A 11: 97,680,776 F1080I probably damaging Het
Olfr608 A G 7: 103,470,882 Y281C probably damaging Het
Plxnc1 T G 10: 94,793,292 probably null Het
Ppp4r2 T C 6: 100,861,465 Y115H probably damaging Het
Pramel1 T A 4: 143,398,818 D437E probably benign Het
Pstpip2 C A 18: 77,861,889 Q133K probably damaging Het
Ptgs2 A T 1: 150,101,260 T41S possibly damaging Het
Slc36a1 G A 11: 55,232,375 A389T probably damaging Het
Vav2 A G 2: 27,426,391 V30A probably damaging Het
Vmn1r119 C T 7: 21,012,131 V109I probably benign Het
Other mutations in Krt16
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00938:Krt16 APN 11 100248717 nonsense probably null
IGL01794:Krt16 APN 11 100247905 missense probably benign 0.00
IGL01795:Krt16 APN 11 100247724 splice site probably benign
IGL02221:Krt16 APN 11 100246336 splice site probably benign
IGL02243:Krt16 APN 11 100246336 splice site probably benign
IGL02410:Krt16 APN 11 100246336 splice site probably benign
IGL02451:Krt16 APN 11 100246336 splice site probably benign
IGL02457:Krt16 APN 11 100246336 splice site probably benign
IGL02512:Krt16 APN 11 100246336 splice site probably benign
IGL02745:Krt16 APN 11 100246336 splice site probably benign
IGL02867:Krt16 APN 11 100247576 missense probably damaging 1.00
PIT4131001:Krt16 UTSW 11 100248749 missense unknown
PIT4472001:Krt16 UTSW 11 100247906 missense probably benign 0.04
R0268:Krt16 UTSW 11 100246525 splice site probably benign
R0709:Krt16 UTSW 11 100246454 splice site probably benign
R1560:Krt16 UTSW 11 100246649 missense probably damaging 1.00
R1728:Krt16 UTSW 11 100247707 missense probably damaging 1.00
R1996:Krt16 UTSW 11 100248788 missense unknown
R3806:Krt16 UTSW 11 100248740 missense unknown
R3907:Krt16 UTSW 11 100247163 missense possibly damaging 0.83
R5133:Krt16 UTSW 11 100247631 missense probably damaging 0.99
R5412:Krt16 UTSW 11 100246767 missense probably damaging 1.00
R5723:Krt16 UTSW 11 100248446 missense probably damaging 0.99
R6270:Krt16 UTSW 11 100247203 missense possibly damaging 0.51
R6368:Krt16 UTSW 11 100246676 missense probably damaging 1.00
R7191:Krt16 UTSW 11 100246658 missense probably damaging 1.00
R7314:Krt16 UTSW 11 100247869 missense probably damaging 1.00
R7446:Krt16 UTSW 11 100246784 frame shift probably null
Predicted Primers PCR Primer
(F):5'- TTGAGGTTCTGCATGGTCAC -3'
(R):5'- AAGAACCTGGAGTCTGAGGC -3'

Sequencing Primer
(F):5'- TTCTCACTGCCCACCAGGAG -3'
(R):5'- AGGCACCCTCAGCATCTG -3'
Posted On2014-12-29