Incidental Mutation 'R2943:Aqp12'
ID255811
Institutional Source Beutler Lab
Gene Symbol Aqp12
Ensembl Gene ENSMUSG00000045091
Gene Nameaquaporin 12
Synonyms
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2943 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location93006334-93012269 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 93006665 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 88 (D88V)
Ref Sequence ENSEMBL: ENSMUSP00000060622 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000059676]
Predicted Effect probably damaging
Transcript: ENSMUST00000059676
AA Change: D88V

PolyPhen 2 Score 0.982 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000060622
Gene: ENSMUSG00000045091
AA Change: D88V

DomainStartEndE-ValueType
Pfam:MIP 6 250 1.3e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191179
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice deficient for this marker have elevated total cholesterol levels and show an increased susceptibility to caerulein induced acute pancreatitis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,356,046 probably null Het
Armc5 A C 7: 128,240,580 N357H probably damaging Het
Atad2b C A 12: 4,942,067 T222K probably damaging Het
Carmil2 C T 8: 105,692,932 H815Y probably benign Het
Chrna9 T C 5: 65,977,095 Y430H probably damaging Het
Eps8 T C 6: 137,522,872 D203G probably damaging Het
Galnt6 G T 15: 100,714,279 probably null Het
Gm5039 T C 12: 88,321,234 D83G probably benign Het
Gsdmc C T 15: 63,803,652 V105I possibly damaging Het
Kntc1 A G 5: 123,797,784 D1509G possibly damaging Het
Lrp10 C T 14: 54,469,845 probably benign Het
Mcmbp A T 7: 128,723,973 L97H probably damaging Het
Mfsd2a A G 4: 122,948,589 L495P possibly damaging Het
Olfr601 A G 7: 103,358,451 C248R probably damaging Het
Pank4 G A 4: 154,971,474 V319I probably benign Het
Pde7a T C 3: 19,230,325 N365D probably damaging Het
Pot1b A T 17: 55,674,058 S319T probably benign Het
Rbm25 T C 12: 83,660,641 I276T probably damaging Het
Reg1 T A 6: 78,428,145 L117Q possibly damaging Het
Ripor3 T C 2: 167,983,761 H759R possibly damaging Het
Rph3al A T 11: 75,834,888 probably null Het
S1pr4 A C 10: 81,498,872 L256R probably damaging Het
Sstr4 T C 2: 148,396,165 V232A probably damaging Het
Tor3a G A 1: 156,674,095 P71S probably benign Het
Zfp804a C A 2: 82,235,879 Q65K probably damaging Het
Other mutations in Aqp12
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0266:Aqp12 UTSW 1 93006850 missense possibly damaging 0.61
R0488:Aqp12 UTSW 1 93008656 missense probably damaging 1.00
R0899:Aqp12 UTSW 1 93006610 missense probably damaging 1.00
R1673:Aqp12 UTSW 1 93006884 missense possibly damaging 0.47
R1714:Aqp12 UTSW 1 93006959 missense possibly damaging 0.79
R1928:Aqp12 UTSW 1 93006610 missense probably damaging 1.00
R2312:Aqp12 UTSW 1 93006809 missense probably benign 0.09
R3803:Aqp12 UTSW 1 93006366 start gained probably benign
R4786:Aqp12 UTSW 1 93006455 missense probably damaging 1.00
R7057:Aqp12 UTSW 1 93011996 missense probably damaging 1.00
R7372:Aqp12 UTSW 1 93006366 start gained probably benign
R7470:Aqp12 UTSW 1 93008663 missense probably damaging 1.00
X0062:Aqp12 UTSW 1 93008597 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GCTAGAAGGGCATCTAAAGCCC -3'
(R):5'- ATGTACGCAGGGTTGAGCTG -3'

Sequencing Primer
(F):5'- TATGCCAGTTTTGCCCG -3'
(R):5'- GCAGTGTGCAGCCATGAG -3'
Posted On2014-12-29