Incidental Mutation 'R2943:Pde7a'
ID 255817
Institutional Source Beutler Lab
Gene Symbol Pde7a
Ensembl Gene ENSMUSG00000069094
Gene Name phosphodiesterase 7A
Synonyms
Accession Numbers
Essential gene? Probably non essential (E-score: 0.180) question?
Stock # R2943 (G1)
Quality Score 225
Status Not validated
Chromosome 3
Chromosomal Location 19277272-19365486 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 19284489 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Asparagine to Aspartic acid at position 365 (N365D)
Ref Sequence ENSEMBL: ENSMUSP00000096800 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091314] [ENSMUST00000099195] [ENSMUST00000156652] [ENSMUST00000149081]
AlphaFold P70453
Predicted Effect probably damaging
Transcript: ENSMUST00000091314
AA Change: N339D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000088863
Gene: ENSMUSG00000069094
AA Change: N339D

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
HDc 183 350 2.91e-10 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000099195
AA Change: N365D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000096800
Gene: ENSMUSG00000069094
AA Change: N365D

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
HDc 209 376 2.91e-10 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139426
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141455
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141621
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148590
Predicted Effect probably benign
Transcript: ENSMUST00000156652
SMART Domains Protein: ENSMUSP00000119685
Gene: ENSMUSG00000069094

DomainStartEndE-ValueType
low complexity region 21 37 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000149081
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.6%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene belongs to the cyclic nucleotide phosphodiesterase (PDE) family, and PDE7 subfamily. This PDE hydrolyzes the second messenger, cAMP, which is a regulator and mediator of a number of cellular responses to extracellular signals. Thus, by regulating the cellular concentration of cAMP, this protein plays a key role in many important physiological processes. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Jul 2011]
PHENOTYPE: Homozygous inactivation of this locus does not impair T cell function but affects the humoral immune response. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 25 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Anln A G 9: 22,267,342 (GRCm39) probably null Het
Aqp12 A T 1: 92,934,387 (GRCm39) D88V probably damaging Het
Armc5 A C 7: 127,839,752 (GRCm39) N357H probably damaging Het
Atad2b C A 12: 4,992,067 (GRCm39) T222K probably damaging Het
Carmil2 C T 8: 106,419,564 (GRCm39) H815Y probably benign Het
Chrna9 T C 5: 66,134,438 (GRCm39) Y430H probably damaging Het
Eif1ad15 T C 12: 88,288,004 (GRCm39) D83G probably benign Het
Eps8 T C 6: 137,499,870 (GRCm39) D203G probably damaging Het
Galnt6 G T 15: 100,612,160 (GRCm39) probably null Het
Gsdmc C T 15: 63,675,501 (GRCm39) V105I possibly damaging Het
Kntc1 A G 5: 123,935,847 (GRCm39) D1509G possibly damaging Het
Lrp10 C T 14: 54,707,302 (GRCm39) probably benign Het
Mcmbp A T 7: 128,325,697 (GRCm39) L97H probably damaging Het
Mfsd2a A G 4: 122,842,382 (GRCm39) L495P possibly damaging Het
Or52s19 A G 7: 103,007,658 (GRCm39) C248R probably damaging Het
Pank4 G A 4: 155,055,931 (GRCm39) V319I probably benign Het
Pot1b A T 17: 55,981,058 (GRCm39) S319T probably benign Het
Rbm25 T C 12: 83,707,415 (GRCm39) I276T probably damaging Het
Reg1 T A 6: 78,405,128 (GRCm39) L117Q possibly damaging Het
Ripor3 T C 2: 167,825,681 (GRCm39) H759R possibly damaging Het
Rph3al A T 11: 75,725,714 (GRCm39) probably null Het
S1pr4 A C 10: 81,334,706 (GRCm39) L256R probably damaging Het
Sstr4 T C 2: 148,238,085 (GRCm39) V232A probably damaging Het
Tor3a G A 1: 156,501,665 (GRCm39) P71S probably benign Het
Zfp804a C A 2: 82,066,223 (GRCm39) Q65K probably damaging Het
Other mutations in Pde7a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01349:Pde7a APN 3 19,283,843 (GRCm39) unclassified probably benign
IGL02644:Pde7a APN 3 19,311,031 (GRCm39) splice site probably benign
IGL02968:Pde7a APN 3 19,297,285 (GRCm39) nonsense probably null
IGL02985:Pde7a APN 3 19,365,047 (GRCm39) missense probably damaging 1.00
R0081:Pde7a UTSW 3 19,295,697 (GRCm39) splice site probably benign
R0736:Pde7a UTSW 3 19,285,207 (GRCm39) missense probably damaging 1.00
R0834:Pde7a UTSW 3 19,284,482 (GRCm39) missense probably damaging 1.00
R1499:Pde7a UTSW 3 19,314,408 (GRCm39) missense possibly damaging 0.49
R1955:Pde7a UTSW 3 19,281,963 (GRCm39) missense probably damaging 0.99
R4072:Pde7a UTSW 3 19,311,017 (GRCm39) missense probably damaging 1.00
R4366:Pde7a UTSW 3 19,365,026 (GRCm39) critical splice donor site probably null
R4524:Pde7a UTSW 3 19,285,140 (GRCm39) missense possibly damaging 0.93
R4666:Pde7a UTSW 3 19,314,420 (GRCm39) missense probably damaging 1.00
R4698:Pde7a UTSW 3 19,365,095 (GRCm39) missense probably damaging 0.99
R4850:Pde7a UTSW 3 19,297,281 (GRCm39) missense probably benign
R4859:Pde7a UTSW 3 19,295,655 (GRCm39) intron probably benign
R5283:Pde7a UTSW 3 19,314,420 (GRCm39) missense probably damaging 1.00
R5646:Pde7a UTSW 3 19,287,937 (GRCm39) missense probably damaging 1.00
R5702:Pde7a UTSW 3 19,295,371 (GRCm39) nonsense probably null
R5756:Pde7a UTSW 3 19,319,009 (GRCm39) missense probably benign 0.08
R5784:Pde7a UTSW 3 19,319,009 (GRCm39) missense probably benign 0.08
R6301:Pde7a UTSW 3 19,297,327 (GRCm39) missense probably benign 0.01
R7136:Pde7a UTSW 3 19,285,258 (GRCm39) missense probably benign 0.36
R7291:Pde7a UTSW 3 19,281,838 (GRCm39) missense probably benign
R7685:Pde7a UTSW 3 19,281,909 (GRCm39) missense probably damaging 1.00
R8032:Pde7a UTSW 3 19,314,429 (GRCm39) missense possibly damaging 0.95
R8884:Pde7a UTSW 3 19,281,858 (GRCm39) missense probably benign
R9408:Pde7a UTSW 3 19,287,958 (GRCm39) missense possibly damaging 0.95
R9648:Pde7a UTSW 3 19,310,966 (GRCm39) missense probably damaging 1.00
R9716:Pde7a UTSW 3 19,285,167 (GRCm39) missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGAATACCCAAGGTCACTCAG -3'
(R):5'- ACTTGGTTCTGGATCCCATGC -3'

Sequencing Primer
(F):5'- CAAATCACATTTCGTCTGTTACTGG -3'
(R):5'- CTGGATCCCATGCACACTG -3'
Posted On 2014-12-29