Incidental Mutation 'R2960:Olfr1410'
ID255868
Institutional Source Beutler Lab
Gene Symbol Olfr1410
Ensembl Gene ENSMUSG00000063583
Gene Nameolfactory receptor 1410
SynonymsMOR208-2, GA_x6K02T2R7CC-81146179-81145211
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.059) question?
Stock #R2960 (G1)
Quality Score225
Status Not validated
Chromosome1
Chromosomal Location92605782-92614806 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 92608328 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Valine at position 164 (I164V)
Ref Sequence ENSEMBL: ENSMUSP00000149621 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073748] [ENSMUST00000079790] [ENSMUST00000216553] [ENSMUST00000217316]
Predicted Effect probably benign
Transcript: ENSMUST00000073748
AA Change: I164V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000073422
Gene: ENSMUSG00000062497
AA Change: I164V

DomainStartEndE-ValueType
low complexity region 16 27 N/A INTRINSIC
Pfam:7tm_4 38 314 7.4e-53 PFAM
Pfam:7tm_1 48 297 1.2e-17 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000079790
AA Change: I164V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000078720
Gene: ENSMUSG00000063583
AA Change: I164V

DomainStartEndE-ValueType
Pfam:7tm_4 38 314 2.6e-50 PFAM
Pfam:7tm_1 48 302 9.2e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000216553
AA Change: I164V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000217316
AA Change: I164V

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.2%
  • 20x: 94.8%
Validation Efficiency
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 24 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Arl5c A G 11: 97,995,076 L33P probably damaging Het
Auh A T 13: 52,839,574 I268N probably damaging Het
Defa25 A T 8: 21,085,257 H84L probably benign Het
E130309D02Rik A T 5: 143,308,021 F234I probably benign Het
Endou T C 15: 97,713,806 Y317C probably damaging Het
Fmn2 C T 1: 174,609,819 L1119F probably damaging Het
Glyat T A 19: 12,639,850 L22H probably damaging Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Grb7 C T 11: 98,452,261 T268I probably damaging Het
Itfg2 G A 6: 128,413,552 A190V probably benign Het
Kirrel C T 3: 87,089,151 M380I probably null Het
Lexm A G 4: 106,613,418 S186P probably damaging Het
Mdga2 G T 12: 66,629,978 Y513* probably null Het
Med8 A G 4: 118,414,747 T222A probably damaging Het
Nup43 T C 10: 7,670,949 V111A probably benign Het
Rfx3 G A 19: 27,900,811 Q29* probably null Het
Rfx8 A G 1: 39,682,952 V291A probably damaging Het
Scnn1a A G 6: 125,322,293 Y112C probably damaging Het
Tex11 C A X: 100,933,415 A487S possibly damaging Het
Tmx3 T C 18: 90,532,992 V252A probably damaging Het
Vmn1r216 A G 13: 23,099,933 D262G probably benign Het
Vmn1r9 A G 6: 57,071,672 D244G possibly damaging Het
Xkr6 T A 14: 63,607,137 M203K possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Olfr1410
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02310:Olfr1410 APN 1 92608065 missense possibly damaging 0.80
R0189:Olfr1410 UTSW 1 92607893 missense probably damaging 0.99
R0520:Olfr1410 UTSW 1 92608749 missense probably damaging 1.00
R0605:Olfr1410 UTSW 1 92607896 missense probably benign 0.02
R1568:Olfr1410 UTSW 1 92607954 missense probably damaging 1.00
R1753:Olfr1410 UTSW 1 92608400 missense probably benign 0.07
R1778:Olfr1410 UTSW 1 92608109 missense possibly damaging 0.88
R4206:Olfr1410 UTSW 1 92608595 missense possibly damaging 0.95
R7379:Olfr1410 UTSW 1 92608467 missense possibly damaging 0.76
Predicted Primers PCR Primer
(F):5'- GGATGTGCCACTCAGTTCTTC -3'
(R):5'- AACGCATTCTGAGGATGGTG -3'

Sequencing Primer
(F):5'- GATGTGCCACTCAGTTCTTCTTTTTC -3'
(R):5'- TGTAACCATAAGAGATGATGACCAC -3'
Posted On2014-12-29