Mutagenetix > Incidental Mutation

Incidental Mutation 'R2960:Scnn1a'

255879

Institutional Source

Beutler Lab

Gene Symbol

Scnn1a

Ensembl Gene

ENSMUSG00000030340

Gene Name

sodium channel, nonvoltage-gated 1 alpha

Synonyms

Scnn1, mENaC, ENaC alpha

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R2960 (G1)

Quality Score

225

Status

Not validated

Chromosome

Chromosomal Location

125297622-125321906 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 125299256 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Tyrosine to Cysteine at position 112 (Y112C)

Ref Sequence

ENSEMBL: ENSMUSP00000134929 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000081440] [ENSMUST00000175966] [ENSMUST00000176110] [ENSMUST00000176365] [ENSMUST00000176442] [ENSMUST00000176655] [ENSMUST00000177329]

AlphaFold

no structure available at present

Predicted Effect

probably damaging
Transcript: ENSMUST00000081440
AA Change: Y138C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000080164
Gene: ENSMUSG00000030340
AA Change: Y138C

Domain	Start	End	E-Value	Type
low complexity region	13	18	N/A	INTRINSIC
Pfam:ASC	88	600	1.1e-93	PFAM
low complexity region	647	677	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000175966
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135551
Gene: ENSMUSG00000030340
AA Change: Y112C

Domain	Start	End	E-Value	Type
Pfam:ASC	62	264	3.5e-28	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176110
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134940
Gene: ENSMUSG00000030340
AA Change: Y112C

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176365
AA Change: Y96C

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)

SMART Domains

Protein: ENSMUSP00000135467
Gene: ENSMUSG00000030340
AA Change: Y96C

Domain	Start	End	E-Value	Type
Pfam:ASC	46	141	1.8e-27	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000176442
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135336
Gene: ENSMUSG00000030340
AA Change: Y31C

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.3e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000176655
AA Change: Y31C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000135798
Gene: ENSMUSG00000030340
AA Change: Y31C

Domain	Start	End	E-Value	Type
Pfam:ASC	1	494	6.4e-105	PFAM
low complexity region	540	570	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000177329
AA Change: Y112C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000134929
Gene: ENSMUSG00000030340
AA Change: Y112C

Domain	Start	End	E-Value	Type
Pfam:ASC	62	575	1.9e-112	PFAM
low complexity region	621	651	N/A	INTRINSIC

Coding Region Coverage

1x: 99.2%
3x: 98.6%
10x: 97.2%
20x: 94.8%

Validation Efficiency

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nonvoltage-gated, amiloride-sensitive, sodium channels control fluid and electrolyte transport across epithelia in many organs. These channels are heteromeric complexes consisting of 3 subunits: alpha, beta, and gamma. This gene encodes the alpha subunit, and mutations in this gene have been associated with pseudohypoaldosteronism type 1 (PHA1), a rare salt wasting disease resulting from target organ unresponsiveness to mineralocorticoids. Alternatively spliced transcript variants encoding different isoforms have been described for this gene. [provided by RefSeq, Apr 2009]
PHENOTYPE: Homozygotes for targeted null mutations exhibit skin with epithelial hyperplasia, abnormal nuclei, premature lipid secretion, and abnormal keratohyaline granules. Mutants die within 40 hours of birth due to inability to clear their lungs of liquid. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 24 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Arl5c	A	G	11: 97,885,902 (GRCm39)	L33P	probably damaging	Het
Auh	A	T	13: 52,993,610 (GRCm39)	I268N	probably damaging	Het
Cimap2	A	G	4: 106,470,615 (GRCm39)	S186P	probably damaging	Het
Defa25	A	T	8: 21,575,273 (GRCm39)	H84L	probably benign	Het
Endou	T	C	15: 97,611,687 (GRCm39)	Y317C	probably damaging	Het
Fmn2	C	T	1: 174,437,385 (GRCm39)	L1119F	probably damaging	Het
Glyat	T	A	19: 12,617,214 (GRCm39)	L22H	probably damaging	Het
Gpd2	C	T	2: 57,228,987 (GRCm39)	R264*	probably null	Het
Grb7	C	T	11: 98,343,087 (GRCm39)	T268I	probably damaging	Het
Ints15	A	T	5: 143,293,776 (GRCm39)	F234I	probably benign	Het
Itfg2	G	A	6: 128,390,515 (GRCm39)	A190V	probably benign	Het
Kirrel1	C	T	3: 86,996,458 (GRCm39)	M380I	probably null	Het
Mdga2	G	T	12: 66,676,752 (GRCm39)	Y513*	probably null	Het
Med8	A	G	4: 118,271,944 (GRCm39)	T222A	probably damaging	Het
Nup43	T	C	10: 7,546,713 (GRCm39)	V111A	probably benign	Het
Or9s14	A	G	1: 92,536,050 (GRCm39)	I164V	probably benign	Het
Rfx3	G	A	19: 27,878,211 (GRCm39)	Q29*	probably null	Het
Rfx8	A	G	1: 39,722,112 (GRCm39)	V291A	probably damaging	Het
Tex11	C	A	X: 99,977,021 (GRCm39)	A487S	possibly damaging	Het
Tmx3	T	C	18: 90,551,116 (GRCm39)	V252A	probably damaging	Het
Vmn1r216	A	G	13: 23,284,103 (GRCm39)	D262G	probably benign	Het
Vmn1r9	A	G	6: 57,048,657 (GRCm39)	D244G	possibly damaging	Het
Xkr6	T	A	14: 63,844,586 (GRCm39)	M203K	possibly damaging	Het
Zfr	G	A	15: 12,162,319 (GRCm39)	R823H	probably benign	Het

Other mutations in Scnn1a

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00227:Scnn1a	APN	6	125,315,342 (GRCm39)	missense	probably benign	0.11
IGL01793:Scnn1a	APN	6	125,320,666 (GRCm39)	missense	probably benign	0.03
IGL01992:Scnn1a	APN	6	125,315,900 (GRCm39)	critical splice donor site	probably null
IGL03280:Scnn1a	APN	6	125,319,744 (GRCm39)	splice site	probably benign
scylla	UTSW	6	125,320,208 (GRCm39)	missense	probably damaging	0.98
R0086:Scnn1a	UTSW	6	125,319,550 (GRCm39)	splice site	probably benign
R0442:Scnn1a	UTSW	6	125,316,100 (GRCm39)	missense	probably damaging	1.00
R0454:Scnn1a	UTSW	6	125,299,189 (GRCm39)	missense	probably damaging	1.00
R0578:Scnn1a	UTSW	6	125,299,207 (GRCm39)	missense	probably damaging	0.97
R1538:Scnn1a	UTSW	6	125,315,856 (GRCm39)	missense	possibly damaging	0.48
R1579:Scnn1a	UTSW	6	125,299,103 (GRCm39)	missense	probably damaging	1.00
R1803:Scnn1a	UTSW	6	125,309,157 (GRCm39)	missense	probably damaging	0.98
R1876:Scnn1a	UTSW	6	125,315,801 (GRCm39)	missense	probably benign	0.05
R2113:Scnn1a	UTSW	6	125,314,774 (GRCm39)	missense	possibly damaging	0.60
R2178:Scnn1a	UTSW	6	125,307,965 (GRCm39)	missense	probably damaging	0.96
R4072:Scnn1a	UTSW	6	125,315,870 (GRCm39)	missense	probably damaging	1.00
R4603:Scnn1a	UTSW	6	125,299,123 (GRCm39)	missense	probably damaging	1.00
R4928:Scnn1a	UTSW	6	125,299,136 (GRCm39)	missense	probably damaging	1.00
R5436:Scnn1a	UTSW	6	125,319,985 (GRCm39)	missense	possibly damaging	0.94
R6812:Scnn1a	UTSW	6	125,314,819 (GRCm39)	missense	probably benign	0.09
R7089:Scnn1a	UTSW	6	125,314,770 (GRCm39)	missense	probably benign	0.05
R8371:Scnn1a	UTSW	6	125,320,806 (GRCm39)	missense	possibly damaging	0.83
R8372:Scnn1a	UTSW	6	125,320,681 (GRCm39)	missense	probably damaging	0.96
R8841:Scnn1a	UTSW	6	125,320,208 (GRCm39)	missense	probably damaging	0.98
R9509:Scnn1a	UTSW	6	125,319,604 (GRCm39)	missense	probably damaging	0.99
X0026:Scnn1a	UTSW	6	125,299,073 (GRCm39)	missense	probably damaging	1.00
Z1176:Scnn1a	UTSW	6	125,320,855 (GRCm39)	missense	probably damaging	0.96

Predicted Primers

PCR Primer
(F):5'- AGGCACTGATCGAGTTCCAC -3'
(R):5'- ACAGCTCCATGACCACTTTTG -3'

Sequencing Primer
(F):5'- GATCGAGTTCCACCGCTC -3'
(R):5'- AGCTCCATGACCACTTTTGTTTGC -3'

Posted On

2014-12-29