Incidental Mutation 'R2962:Ube3c'
ID255920
Institutional Source Beutler Lab
Gene Symbol Ube3c
Ensembl Gene ENSMUSG00000039000
Gene Nameubiquitin protein ligase E3C
Synonyms
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.367) question?
Stock #R2962 (G1)
Quality Score225
Status Not validated
Chromosome5
Chromosomal Location29569242-29676092 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 29658418 bp
ZygosityHeterozygous
Amino Acid Change Alanine to Aspartic acid at position 897 (A897D)
Ref Sequence ENSEMBL: ENSMUSP00000045998 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049453]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049453
AA Change: A897D

PolyPhen 2 Score 0.806 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000045998
Gene: ENSMUSG00000039000
AA Change: A897D

DomainStartEndE-ValueType
IQ 44 66 1.68e-3 SMART
low complexity region 363 376 N/A INTRINSIC
low complexity region 496 514 N/A INTRINSIC
Blast:HECTc 645 701 5e-25 BLAST
HECTc 742 1083 8.54e-178 SMART
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,579,317 T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cog3 A G 14: 75,740,534 probably null Het
Gm3371 A T 14: 44,408,698 N103K probably benign Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hoxc10 A G 15: 102,967,300 Y148C probably damaging Het
Jade1 C G 3: 41,613,327 T610S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Malt1 A G 18: 65,448,335 H278R probably benign Het
Mlxip C A 5: 123,440,824 R178S probably damaging Het
Olfr539 A T 7: 140,667,949 M214L probably benign Het
Pdxk A G 10: 78,443,833 L236P probably damaging Het
Plekhg3 G A 12: 76,572,659 probably null Het
Rufy2 G T 10: 63,000,260 V323F probably damaging Het
Serpinb7 A G 1: 107,451,726 T288A probably benign Het
Tet1 A T 10: 62,814,544 C1628* probably null Het
Tgtp2 A G 11: 49,059,536 S70P probably damaging Het
Tmem211 T C 5: 113,238,056 V123A possibly damaging Het
Trank1 C T 9: 111,352,080 T390I probably damaging Het
Trim31 T C 17: 36,899,904 S143P probably damaging Het
Unc79 A T 12: 103,095,119 T1050S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Ube3c
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00557:Ube3c APN 5 29619229 missense probably damaging 1.00
IGL01526:Ube3c APN 5 29667962 missense probably damaging 0.99
IGL01901:Ube3c APN 5 29668007 missense probably damaging 1.00
IGL02029:Ube3c APN 5 29619328 missense probably damaging 1.00
IGL02893:Ube3c APN 5 29632763 missense probably damaging 1.00
IGL03400:Ube3c APN 5 29601347 missense probably benign 0.00
lord_business UTSW 5 29637586 splice site probably benign
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0067:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R0099:Ube3c UTSW 5 29607064 missense probably damaging 1.00
R0606:Ube3c UTSW 5 29590928 missense probably damaging 1.00
R0755:Ube3c UTSW 5 29637742 missense probably damaging 1.00
R0900:Ube3c UTSW 5 29601346 missense probably benign 0.00
R1624:Ube3c UTSW 5 29646619 missense probably benign 0.00
R1701:Ube3c UTSW 5 29601202 missense probably benign
R1918:Ube3c UTSW 5 29587317 missense probably damaging 1.00
R1933:Ube3c UTSW 5 29619659 missense probably damaging 0.97
R2072:Ube3c UTSW 5 29635640 missense probably benign 0.02
R2095:Ube3c UTSW 5 29668040 missense probably damaging 1.00
R2122:Ube3c UTSW 5 29619606 missense probably benign 0.14
R3605:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3606:Ube3c UTSW 5 29598938 missense possibly damaging 0.94
R3764:Ube3c UTSW 5 29637586 splice site probably benign
R3940:Ube3c UTSW 5 29619360 missense probably benign 0.31
R4776:Ube3c UTSW 5 29632838 critical splice donor site probably null
R4794:Ube3c UTSW 5 29597085 missense probably benign 0.06
R4924:Ube3c UTSW 5 29631271 missense possibly damaging 0.56
R5059:Ube3c UTSW 5 29631295 missense probably null 0.11
R5068:Ube3c UTSW 5 29601354 critical splice donor site probably null
R5140:Ube3c UTSW 5 29635711 missense probably damaging 1.00
R5849:Ube3c UTSW 5 29658409 missense probably damaging 1.00
R5890:Ube3c UTSW 5 29658292 missense possibly damaging 0.77
R5956:Ube3c UTSW 5 29599056 intron probably benign
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6035:Ube3c UTSW 5 29601163 missense probably benign 0.00
R6264:Ube3c UTSW 5 29590831 missense probably damaging 1.00
R6354:Ube3c UTSW 5 29663583 missense probably damaging 0.99
R6658:Ube3c UTSW 5 29602217 missense probably damaging 1.00
R6877:Ube3c UTSW 5 29587318 missense probably benign 0.22
Predicted Primers PCR Primer
(F):5'- AACATGTTGGTGGAGCTACC -3'
(R):5'- TAGCTTCAGCACAACCAGGG -3'

Sequencing Primer
(F):5'- TGGAGCTACCCTTTGCTGGC -3'
(R):5'- TTCAGCACAACCAGGGATACAATTC -3'
Posted On2014-12-29