Incidental Mutation 'R2962:Tet1'
ID255928
Institutional Source Beutler Lab
Gene Symbol Tet1
Ensembl Gene ENSMUSG00000047146
Gene Nametet methylcytosine dioxygenase 1
SynonymsBB001228, 2510010B09Rik, D10Ertd17e, Cxxc6
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R2962 (G1)
Quality Score225
Status Not validated
Chromosome10
Chromosomal Location62804570-62908996 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 62814544 bp
ZygosityHeterozygous
Amino Acid Change Cysteine to Stop codon at position 1628 (C1628*)
Ref Sequence ENSEMBL: ENSMUSP00000133279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000050826] [ENSMUST00000174121] [ENSMUST00000174189]
Predicted Effect probably null
Transcript: ENSMUST00000050826
AA Change: C1596*
SMART Domains Protein: ENSMUSP00000059527
Gene: ENSMUSG00000047146
AA Change: C1596*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.5e-11 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1931 1e-171 SMART
low complexity region 1944 1956 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000173087
SMART Domains Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 2 138 2.64e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173087
SMART Domains Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 2 138 2.64e-3 SMART
Predicted Effect probably null
Transcript: ENSMUST00000173087
SMART Domains Protein: ENSMUSP00000133706
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 2 138 2.64e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000173905
SMART Domains Protein: ENSMUSP00000134571
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Pfam:Tet_JBP 1 61 2.4e-20 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174121
SMART Domains Protein: ENSMUSP00000134328
Gene: ENSMUSG00000047146

DomainStartEndE-ValueType
Tet_JBP 1 352 1.49e-83 SMART
low complexity region 365 377 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000174189
AA Change: C1628*
SMART Domains Protein: ENSMUSP00000133279
Gene: ENSMUSG00000047146
AA Change: C1628*

DomainStartEndE-ValueType
low complexity region 8 21 N/A INTRINSIC
low complexity region 118 132 N/A INTRINSIC
low complexity region 553 564 N/A INTRINSIC
Pfam:zf-CXXC 566 607 2.7e-10 PFAM
low complexity region 884 902 N/A INTRINSIC
low complexity region 1087 1106 N/A INTRINSIC
Tet_JBP 1528 1963 7.36e-170 SMART
low complexity region 1976 1988 N/A INTRINSIC
Coding Region Coverage
  • 1x: 99.2%
  • 3x: 98.6%
  • 10x: 97.3%
  • 20x: 95.1%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DNA methylation is an epigenetic mechanism that is important for controlling gene expression. The protein encoded by this gene is a demethylase that belongs to the TET (ten-eleven translocation) family. Members of the TET protein family play a role in the DNA methylation process and gene activation. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit background sensitive lethality, abnormal forebrain development, abnormal female reproductive organs and decreased litter size. Mice homozygous for a different knock-out allele exhibit impaired adult neurogenesis, impaired spatial learning and impaired short-term memory retention. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 22 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Cd24a A G 10: 43,579,317 T22A probably benign Het
Cdk5rap2 ATGTG ATG 4: 70,289,977 probably null Het
Cog3 A G 14: 75,740,534 probably null Het
Gm3371 A T 14: 44,408,698 N103K probably benign Het
Gpd2 C T 2: 57,338,975 R264* probably null Het
Hoxc10 A G 15: 102,967,300 Y148C probably damaging Het
Jade1 C G 3: 41,613,327 T610S probably benign Het
Klk14 G A 7: 43,692,077 C51Y probably damaging Het
Malt1 A G 18: 65,448,335 H278R probably benign Het
Mlxip C A 5: 123,440,824 R178S probably damaging Het
Olfr539 A T 7: 140,667,949 M214L probably benign Het
Pdxk A G 10: 78,443,833 L236P probably damaging Het
Plekhg3 G A 12: 76,572,659 probably null Het
Rufy2 G T 10: 63,000,260 V323F probably damaging Het
Serpinb7 A G 1: 107,451,726 T288A probably benign Het
Tgtp2 A G 11: 49,059,536 S70P probably damaging Het
Tmem211 T C 5: 113,238,056 V123A possibly damaging Het
Trank1 C T 9: 111,352,080 T390I probably damaging Het
Trim31 T C 17: 36,899,904 S143P probably damaging Het
Ube3c C A 5: 29,658,418 A897D possibly damaging Het
Unc79 A T 12: 103,095,119 T1050S possibly damaging Het
Zfr G A 15: 12,162,233 R823H probably benign Het
Other mutations in Tet1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00539:Tet1 APN 10 62814497 missense probably damaging 1.00
IGL01079:Tet1 APN 10 62879473 missense probably damaging 0.99
IGL01109:Tet1 APN 10 62879774 missense probably benign
IGL01634:Tet1 APN 10 62878588 missense possibly damaging 0.94
IGL02003:Tet1 APN 10 62816400 missense possibly damaging 0.92
IGL02081:Tet1 APN 10 62813818 missense probably damaging 1.00
IGL02100:Tet1 APN 10 62812728 missense possibly damaging 0.92
IGL02228:Tet1 APN 10 62813734 missense probably damaging 0.99
IGL02524:Tet1 APN 10 62878646 missense probably damaging 1.00
IGL02539:Tet1 APN 10 62813019 missense possibly damaging 0.60
IGL02608:Tet1 APN 10 62879609 missense possibly damaging 0.82
IGL02608:Tet1 APN 10 62839087 missense probably damaging 1.00
IGL02702:Tet1 APN 10 62879752 missense possibly damaging 0.83
K7371:Tet1 UTSW 10 62879176 missense probably benign
R0166:Tet1 UTSW 10 62840279 missense probably benign 0.05
R0371:Tet1 UTSW 10 62878399 missense probably damaging 0.97
R0373:Tet1 UTSW 10 62878209 nonsense probably null
R0391:Tet1 UTSW 10 62814546 unclassified probably null
R0445:Tet1 UTSW 10 62879941 missense probably benign 0.08
R1016:Tet1 UTSW 10 62879950 missense probably benign
R1344:Tet1 UTSW 10 62814521 missense probably damaging 1.00
R1546:Tet1 UTSW 10 62812910 missense probably damaging 1.00
R1651:Tet1 UTSW 10 62879674 missense probably damaging 1.00
R1725:Tet1 UTSW 10 62814477 missense probably damaging 1.00
R1752:Tet1 UTSW 10 62812989 missense probably damaging 0.99
R1834:Tet1 UTSW 10 62813665 missense probably damaging 0.99
R1964:Tet1 UTSW 10 62812947 missense possibly damaging 0.86
R2239:Tet1 UTSW 10 62879734 missense probably benign 0.01
R3084:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3086:Tet1 UTSW 10 62879621 missense probably benign 0.34
R3972:Tet1 UTSW 10 62813726 missense probably damaging 1.00
R4622:Tet1 UTSW 10 62819474 missense possibly damaging 0.92
R4674:Tet1 UTSW 10 62838848 missense probably damaging 0.97
R4687:Tet1 UTSW 10 62838791 missense probably benign 0.04
R4718:Tet1 UTSW 10 62813812 missense probably damaging 0.96
R4801:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4802:Tet1 UTSW 10 62822663 missense probably damaging 0.99
R4903:Tet1 UTSW 10 62822658 missense probably damaging 1.00
R5153:Tet1 UTSW 10 62878578 missense possibly damaging 0.85
R5193:Tet1 UTSW 10 62838247 missense probably benign 0.22
R5225:Tet1 UTSW 10 62838671 missense probably damaging 1.00
R5437:Tet1 UTSW 10 62814451 missense probably benign 0.01
R5465:Tet1 UTSW 10 62839777 missense probably benign
R5535:Tet1 UTSW 10 62832907 missense probably damaging 1.00
R5586:Tet1 UTSW 10 62878294 missense probably damaging 1.00
R5763:Tet1 UTSW 10 62840068 missense probably damaging 1.00
R5788:Tet1 UTSW 10 62839958 missense possibly damaging 0.70
R5818:Tet1 UTSW 10 62816408 missense possibly damaging 0.71
R5860:Tet1 UTSW 10 62812620 unclassified probably null
R5975:Tet1 UTSW 10 62879773 missense probably benign 0.37
R6041:Tet1 UTSW 10 62813373 missense probably damaging 0.98
R6092:Tet1 UTSW 10 62813715 missense probably benign 0.10
R6132:Tet1 UTSW 10 62813300 missense probably damaging 0.99
R6157:Tet1 UTSW 10 62839970 missense probably damaging 0.98
R6520:Tet1 UTSW 10 62880013 start codon destroyed probably null 0.53
R7210:Tet1 UTSW 10 62814501 missense probably null 0.95
R7223:Tet1 UTSW 10 62813671 missense possibly damaging 0.95
R7255:Tet1 UTSW 10 62822636 missense probably benign 0.15
R7323:Tet1 UTSW 10 62880039 start gained probably benign
R7472:Tet1 UTSW 10 62813350 missense possibly damaging 0.84
R7507:Tet1 UTSW 10 62832892 critical splice donor site probably null
R7522:Tet1 UTSW 10 62818983 missense possibly damaging 0.82
Predicted Primers PCR Primer
(F):5'- GCTGGGATTAAAGCCTTGTCC -3'
(R):5'- ACGAGGTCACTCAAAACTGTC -3'

Sequencing Primer
(F):5'- CTGGCTGCCTTCAGATCAAAATG -3'
(R):5'- GGTCACTCAAAACTGTCCCGTTTTG -3'
Posted On2014-12-29